ID: 1148856260

View in Genome Browser
Species Human (GRCh38)
Location 17:50580736-50580758
Sequence GTCCGCATACCTGGTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148856257_1148856260 -9 Left 1148856257 17:50580722-50580744 CCAGGGAGGGTTTTGTCCGCATA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1148856260 17:50580736-50580758 GTCCGCATACCTGGTGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 90
1148856252_1148856260 18 Left 1148856252 17:50580695-50580717 CCTCACTCAGTGACAGCAGTGTC 0: 1
1: 0
2: 1
3: 18
4: 170
Right 1148856260 17:50580736-50580758 GTCCGCATACCTGGTGCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148856260 Original CRISPR GTCCGCATACCTGGTGCTGA GGG Intronic