ID: 1148856593

View in Genome Browser
Species Human (GRCh38)
Location 17:50582350-50582372
Sequence CCCTGGAAATGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148856587_1148856593 14 Left 1148856587 17:50582313-50582335 CCGGCAGTGGTCCAGGCAGTTCA 0: 1
1: 0
2: 2
3: 14
4: 154
Right 1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 48
4: 521
1148856588_1148856593 3 Left 1148856588 17:50582324-50582346 CCAGGCAGTTCATACTACATCTT 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG 0: 1
1: 0
2: 2
3: 48
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148856593 Original CRISPR CCCTGGAAATGGAGAGCAGA GGG Intronic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
900557028 1:3285697-3285719 CCCTGGAAATGGCTAGATGAAGG + Intronic
900903550 1:5534484-5534506 ACCTGGAAATGGAGTGCTGCTGG - Intergenic
900998136 1:6133881-6133903 GCCTGGACATGCAGACCAGAAGG + Intronic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902038642 1:13476056-13476078 CCCTGCCCATGGAGAGCAGGAGG - Exonic
902384696 1:16069629-16069651 CCCTGGAACTGGAGAGAAGGGGG + Intronic
902673005 1:17987979-17988001 CCCTGGGGAGGGAGAGCAGGCGG + Intergenic
902730527 1:18365786-18365808 CCATGGAAAGGGGGAGGAGATGG + Intronic
902820560 1:18940658-18940680 TCCTGGCAAAGAAGAGCAGAAGG + Intronic
902978603 1:20107484-20107506 CCCAGGAACTGCAGAGCAGAAGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903190961 1:21655829-21655851 CCCTGGAAAGGGGGAGCTGGAGG - Intronic
903580660 1:24368156-24368178 CCCTAGACCTGGAGGGCAGAAGG + Intronic
904461529 1:30683605-30683627 CTCTGGAAATGGAGAGCATCTGG - Intergenic
904564578 1:31420913-31420935 ACGTGGAAATTGAGACCAGAGGG - Intronic
906148186 1:43572347-43572369 CCTTGGACCTGGAAAGCAGAAGG - Intronic
906517190 1:46446707-46446729 CCCAGGAATTGCACAGCAGAGGG + Intergenic
907641270 1:56192900-56192922 ACCTCGAAATGGAGATCATAAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909465317 1:75967295-75967317 TCGTGGTAATGGAGAGCAGTGGG - Intergenic
910280691 1:85498147-85498169 CCCTGGAGAAGGAGAAGAGAAGG - Intronic
911862780 1:102974882-102974904 CCCTGGAAATAAAAAGCAGTGGG + Exonic
912140973 1:106726842-106726864 TCATGGACATGGAGAGTAGAAGG + Intergenic
912518222 1:110228876-110228898 CTCTGGAACCGGAGAGCAAAGGG + Intronic
913320129 1:117582269-117582291 TACAGGAAATGGGGAGCAGAAGG - Intergenic
913334442 1:117696111-117696133 CCCTGGAAATGACCAGCAAAGGG - Intergenic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915899567 1:159836655-159836677 CCCAGGAACTGGGGAGAAGAGGG - Exonic
916670688 1:167016944-167016966 CCATGGAGATAGAGAGTAGAAGG + Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916757574 1:167787799-167787821 CCCTGGAAAAGGGAAGCAGAAGG - Exonic
916876972 1:168979621-168979643 GCCTGGAAATGCAGAGCACGAGG - Intergenic
917414552 1:174795364-174795386 CCTTATAAATGGAGAGGAGATGG + Intronic
917500364 1:175579742-175579764 CCTTGGAAATAGAGGGGAGAGGG + Intronic
918178487 1:182065959-182065981 CACTAGAAATGGAGAGCGGAAGG + Intergenic
918581462 1:186135766-186135788 CACTGGAAATGGAGGGGAAAAGG - Intronic
920550172 1:206854047-206854069 CCATGGAGATAGAGAGTAGAAGG + Intergenic
920812166 1:209296463-209296485 CCCCGGAAAGGGAAAGGAGAGGG + Intergenic
921044451 1:211464281-211464303 TCATGGACATGGAGAGCAAAAGG + Intergenic
921248775 1:213276798-213276820 CACTGGAAAAGGAGAGTTGAAGG + Intergenic
922470079 1:225871112-225871134 CCCTGGAAACGGAGAGAACAGGG + Exonic
923066029 1:230518115-230518137 CCCTGGCAGCGCAGAGCAGATGG + Intergenic
923264841 1:232304456-232304478 CCCTGGAGATAGAGAGCAAATGG - Intergenic
924013000 1:239686486-239686508 CCCAGGGAAGGGTGAGCAGAAGG - Intronic
924517843 1:244781072-244781094 TCCTGGAAACCGAGAGAAGAAGG - Intergenic
924789647 1:247233404-247233426 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1062979611 10:1710969-1710991 ACATGGAAATGCAGAGCACAGGG - Intronic
1063713769 10:8506895-8506917 TCATGGACATGGAGAGTAGAAGG - Intergenic
1063954767 10:11255735-11255757 TCCTAGAAATGGAGAGAAGGTGG - Intronic
1064365953 10:14708030-14708052 GGCTGGAAATGGAAAGGAGAGGG - Intronic
1065978316 10:30863836-30863858 CGGTGGAAGTGGAGAGCACAAGG - Intronic
1067778460 10:49179633-49179655 CCCCAAAAATGGAGAGAAGAAGG + Intronic
1069591130 10:69642650-69642672 CCCAAGAAATGGGGAGCAGAGGG - Intergenic
1069953615 10:72036192-72036214 CCTTGGAAATGGAGGCCCGAGGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070656822 10:78277394-78277416 CCCTGGAAAGGGAGAGAAACAGG - Intergenic
1071019940 10:81041512-81041534 CCCAGGAAATGCACAGCTGAAGG + Intergenic
1071474782 10:86016799-86016821 CCCCGCAAATGGTGAGCAGCTGG + Intronic
1071644211 10:87344598-87344620 CCCTGGTAGTGGAAAGTAGAAGG + Intergenic
1072920290 10:99571139-99571161 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1073073619 10:100809874-100809896 CCCTACAAATGAAGAGCAGCAGG + Intronic
1073906561 10:108287468-108287490 CCCTGGAAATGTAGGGTAAAAGG + Intergenic
1074874140 10:117601356-117601378 GCCTGGAAATGGAGGGCCAATGG - Intergenic
1075112447 10:119598061-119598083 CCCTGAAAATGGACAACATAAGG - Intergenic
1075203100 10:120422643-120422665 GGCTGGAAATGGAGAGCGGTGGG + Intergenic
1075298249 10:121297015-121297037 CGATGAAAATGTAGAGCAGATGG + Intergenic
1075602296 10:123778814-123778836 CCCTCAAAATGTAGAGCAGCAGG + Intronic
1075992850 10:126852658-126852680 CTCAGGAAAGGGAGACCAGATGG - Intergenic
1076426830 10:130372981-130373003 CCCTGGAGGTAGAGAGGAGAGGG - Intergenic
1076684093 10:132189150-132189172 CCCTGGAAACCCAGAGCAGGCGG + Intronic
1076889283 10:133276052-133276074 CCCTGGTATCCGAGAGCAGAGGG + Intronic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077661531 11:4072880-4072902 CCCTGAAAATGAACACCAGATGG - Intronic
1077889687 11:6410334-6410356 GCCTGAAAATGCTGAGCAGAGGG + Intronic
1078194120 11:9120856-9120878 CCAGGGAAATCGAGAGCAGCAGG - Intronic
1078513792 11:12006880-12006902 ACCTGGATAAGGAAAGCAGATGG + Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1079405131 11:20138415-20138437 TCTTGGTAAAGGAGAGCAGAGGG - Intergenic
1080897197 11:36456499-36456521 CCCTGGAAATTCAGAGGAGAAGG - Intronic
1081786094 11:45748739-45748761 TCCCGGAAATGGAGAGAGGAAGG - Intergenic
1082643584 11:55693946-55693968 CCCTAGAAAAGCAGAGCATATGG + Intergenic
1083028380 11:59570099-59570121 CCCATAAAATGGAGGGCAGAGGG - Intergenic
1083533290 11:63445027-63445049 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1083967309 11:66050771-66050793 CCCTGTAACTGGAGAGCCCAGGG - Intronic
1084318427 11:68359361-68359383 CCCTGGAAGTGCAGACCAGCGGG + Intronic
1084383123 11:68826068-68826090 CCCTGGCCCTGGAGAGTAGAGGG + Intronic
1084680793 11:70665081-70665103 CCCTGGATGTCGAGATCAGAGGG - Intronic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085386861 11:76162607-76162629 CCCTGGAGAAGGAGGGCAGGTGG - Intergenic
1085819901 11:79781102-79781124 CCCTGGGAATGGAAACCACAAGG - Intergenic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1087058607 11:93957113-93957135 CCATGGAAGTGGAGAGGGGAGGG - Intergenic
1087416768 11:97866523-97866545 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1087697085 11:101391894-101391916 GCCCGGAAATGCAGGGCAGATGG - Intergenic
1088095849 11:106100677-106100699 CCCTGGAAAGGGAAAGATGAAGG - Intergenic
1088929761 11:114339837-114339859 CCTTGCATATGGGGAGCAGAGGG + Intergenic
1089609226 11:119660300-119660322 CCCAGGAGATGGGAAGCAGATGG + Intronic
1089824075 11:121257017-121257039 CTCTGGAAATGCAGAGGTGATGG + Intergenic
1090228770 11:125087033-125087055 CCCTGGAAGAGGGGAGCAGGGGG + Intronic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090941213 11:131389893-131389915 CCCGGGGAAAGGAGACCAGAAGG + Intronic
1091446791 12:548318-548340 CCCTGGAGATGGAGGCCAGGTGG + Intronic
1091603985 12:1935037-1935059 CCCGGGCAGTGGGGAGCAGAGGG + Intergenic
1091715420 12:2773115-2773137 TCATGTAAATGGAGAGGAGAGGG - Intergenic
1092121828 12:6049815-6049837 TCATGGAAATGAAGGGCAGAAGG - Intronic
1092258160 12:6938217-6938239 CCCAGGAAATGGAGCCCAAAAGG + Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092571836 12:9733907-9733929 CCTGGAAAATGGAGAGTAGATGG + Intergenic
1093317345 12:17667363-17667385 CCCTGTCAAGGGAGATCAGATGG - Intergenic
1093620972 12:21288473-21288495 TCATGGAGATAGAGAGCAGAAGG + Intronic
1093765409 12:22956175-22956197 CTCTGGAAATGCAGATCAAAAGG - Intergenic
1094186499 12:27648808-27648830 CCATGGAGATAGAGAGTAGAGGG + Intronic
1095334852 12:41012175-41012197 CCCTTGATCTGGAGAGCACATGG - Intronic
1095400918 12:41814056-41814078 GCCTGGGAATGGAGTGTAGAGGG + Intergenic
1095815305 12:46415497-46415519 TCATGGAAACAGAGAGCAGAAGG - Intergenic
1096025112 12:48353562-48353584 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1098952362 12:76654116-76654138 CCCTTGTTAAGGAGAGCAGATGG - Intergenic
1099763688 12:86954395-86954417 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1100360305 12:93871593-93871615 TCCTGGACATAGAGAGTAGAAGG - Intronic
1100995882 12:100300676-100300698 TCATGGAGATGGAGAGTAGAAGG - Intronic
1101707936 12:107238015-107238037 CCCAGGAAATGGAGTCCAGCTGG + Intergenic
1101733296 12:107444116-107444138 CCCTGGAATTTGAGATAAGAAGG + Intronic
1102438975 12:112947000-112947022 CCCCGGGACAGGAGAGCAGATGG - Intronic
1102939130 12:116923234-116923256 CCCTGGAAATTCAGGGCAGTAGG + Intronic
1103606295 12:122088186-122088208 CCCTGGAGAGGGACAGCAGAGGG - Intronic
1103932955 12:124460270-124460292 ACCTGGAAATGGAGTGCGGCTGG + Intronic
1104041191 12:125132288-125132310 CCCCGGAAATGCAGAGAAAAAGG - Intronic
1104451490 12:128872331-128872353 CCCTATAAATGCAGTGCAGAGGG + Intronic
1104746664 12:131215157-131215179 CCCTGGGAATGGGGATCAGTGGG + Intergenic
1104764087 12:131315310-131315332 CCCTGGGGATGGGGAGCAGGTGG + Intergenic
1104785896 12:131447757-131447779 CCCTGGGAATGGGGATCAGTGGG - Intergenic
1107422524 13:40261808-40261830 CCCAGGAAATGCAGAACAGTGGG - Intergenic
1107565910 13:41604173-41604195 CCCTGGACATTGAGAGCACCAGG - Intronic
1107717670 13:43216742-43216764 CCTTGGAAATGTAGGGAAGAAGG + Intronic
1107785143 13:43948076-43948098 TCCTGGCATGGGAGAGCAGAGGG - Intergenic
1108624113 13:52210794-52210816 TCCTGGATAAGGAGAGCAGTGGG - Intergenic
1108973707 13:56409407-56409429 CCATGGAAATAGAGAGTAGAAGG + Intergenic
1109999247 13:70173471-70173493 GCCTGGAAGTGAAGAGGAGAGGG + Intergenic
1111412942 13:87900021-87900043 ACCTGAAAGTGGAGAGTAGAAGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111517411 13:89352614-89352636 CACTGAAAATGGAGAACAGGAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111706747 13:91759553-91759575 TCATGGAGATGGAGAGTAGAAGG - Intronic
1112223470 13:97514514-97514536 GCCTGGGAATGGAGCGGAGAAGG + Intergenic
1112232794 13:97606498-97606520 TCCTGGAAAGGGAGGGAAGAAGG - Intergenic
1114499390 14:23156812-23156834 CCCTGGAAATGGAGGAATGAGGG - Intronic
1114747324 14:25163635-25163657 TCCTGGAGATAGAGAGTAGAAGG - Intergenic
1114827999 14:26104981-26105003 TTCTGGAAAGAGAGAGCAGAGGG + Intergenic
1115923622 14:38406513-38406535 TCCTTGAAATGCAGAGCATAAGG + Intergenic
1115949292 14:38701718-38701740 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1116163794 14:41307301-41307323 GCCTGGAAAGAGAGAGCAGTGGG - Intergenic
1116393953 14:44425938-44425960 ACTTGGAAATTGAGAGTAGAAGG + Intergenic
1116577115 14:46588385-46588407 CCTTGGAAATTGAGGGCAGTCGG - Intergenic
1117054881 14:51901657-51901679 CCCTGACAACGTAGAGCAGAGGG - Intronic
1118378408 14:65197373-65197395 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1118745150 14:68768064-68768086 CCCAGGAGATGGAGAACAGCCGG + Intergenic
1120121038 14:80680406-80680428 TCCTGGGCATGGAGCGCAGAGGG - Intronic
1121031111 14:90659519-90659541 CCATGGAAAGGGAGAGAAAAGGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1122814255 14:104304512-104304534 CCCTGGAAATGAGGAGCATCTGG - Intergenic
1122865927 14:104603970-104603992 CCCGGGAAAGGGACGGCAGATGG - Intronic
1122903905 14:104793227-104793249 CCATGGACAGGGAGAGCAAACGG - Exonic
1124630143 15:31331527-31331549 GCCTGGGAAAGCAGAGCAGAGGG + Intronic
1124793839 15:32756250-32756272 TCCTGGACATAGAGAGTAGAAGG - Intergenic
1124823186 15:33067954-33067976 TCCTGTAAATTAAGAGCAGATGG - Intronic
1125294688 15:38190102-38190124 CCCTGGTAAAGGAGAGAAGGCGG - Intergenic
1125472996 15:40022710-40022732 CAATGGAAAGGGAGAGTAGAGGG - Intronic
1126521631 15:49601823-49601845 TCATGGAAATAGAGAGCAGAAGG - Intronic
1127836514 15:62795077-62795099 CTCTGGAAGAGGAGAGCAGGGGG + Intronic
1128034072 15:64507768-64507790 CATTTGAAATAGAGAGCAGAGGG + Intronic
1129268265 15:74406270-74406292 ACCTGGAAATGGTGAGGAGTGGG + Intergenic
1129545951 15:76395030-76395052 TCATGGAGATGGAGAGTAGAAGG - Intronic
1129607041 15:77030052-77030074 CCCAGTAAAGGCAGAGCAGAAGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1131284399 15:91045121-91045143 CCCTGGGTTTGGAGAGCAGGAGG + Intergenic
1131550110 15:93350009-93350031 CCCTGGCAATCAACAGCAGATGG - Intergenic
1131983192 15:98016162-98016184 TCCTGTAAATGGAGAGCACCTGG - Intergenic
1132087555 15:98920878-98920900 ACCTGGAAGGGGAGAGCAGAGGG - Intronic
1132593579 16:737746-737768 CACAGGAAGAGGAGAGCAGAGGG + Intronic
1132857110 16:2050979-2051001 GCGTGGAAATGGGGAGCAAAGGG + Intronic
1133030284 16:3007629-3007651 CCCTGCAAGTGGGGAGCAAAGGG + Intergenic
1133056672 16:3148869-3148891 CCCTGGGATTGGAAGGCAGAGGG + Intronic
1133236424 16:4389327-4389349 CCCTGGCAGTGGGGAGCTGAGGG + Intronic
1133781194 16:8940675-8940697 CCCTGGAAATGTCTAGAAGATGG - Intronic
1133809831 16:9152833-9152855 CCCTGGGAGGGGTGAGCAGAGGG - Intergenic
1135299835 16:21316433-21316455 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1136559134 16:31028361-31028383 CCCAGAAGACGGAGAGCAGAAGG + Intergenic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1140267701 16:73434731-73434753 CCCAGCAACTGGAGAACAGAAGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141117692 16:81324524-81324546 ACCTGGAGATGGTGAGCAAAGGG + Intronic
1141571126 16:84934228-84934250 CCCTGGCAATGGAGAGAGGGAGG - Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1143187549 17:5019812-5019834 CACGGGAAAGGAAGAGCAGAAGG - Intronic
1143198626 17:5097024-5097046 CCCTGCAAATGGAGGTCAGCTGG + Intergenic
1143256869 17:5564380-5564402 TCATGGACATAGAGAGCAGAAGG - Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144322869 17:14147460-14147482 CCATGGAGATAGAGAGTAGAAGG + Intronic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1145882176 17:28360311-28360333 CCCTGGAACAGGAGAGTAGATGG + Intronic
1146212933 17:30956220-30956242 TCCTGAAAATGGAGAGTACAGGG - Exonic
1147653758 17:42076858-42076880 TCCTGGTAATGGAGAGCTGGGGG + Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1148960780 17:51390997-51391019 CCCAGGGGATGCAGAGCAGATGG + Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150005965 17:61469179-61469201 CTCTAGAAAGTGAGAGCAGAGGG + Intronic
1150483827 17:65530759-65530781 GCCTGGAAATGGGGAGAAGAGGG - Intronic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1151398184 17:73838859-73838881 CCCTGGTGATGGAAAGCAGGGGG - Intergenic
1151443074 17:74146060-74146082 CCCTGGACACGGAGTGGAGAAGG + Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152152839 17:78613435-78613457 ACATGCAAATGGAGACCAGATGG - Intergenic
1152527092 17:80894455-80894477 GCCTGGAAATGGAAATCTGACGG + Intronic
1152997478 18:421249-421271 CCATGTTAATAGAGAGCAGATGG + Intronic
1153274064 18:3350866-3350888 CCCCGGAGATGGAGACCAGCCGG + Intergenic
1153577472 18:6536978-6537000 TCCTGGGAATGGAGGGCTGAAGG + Intronic
1153989345 18:10382154-10382176 ACATGGAAAGGAAGAGCAGATGG - Intergenic
1154447790 18:14449411-14449433 CCCAGGACATGCAGTGCAGACGG - Intergenic
1155094240 18:22540768-22540790 CCTTGGAAGTGGAGAAGAGAAGG - Intergenic
1155803939 18:30142597-30142619 CCTTGGAAATTGAGGGCAGTTGG - Intergenic
1156425399 18:37005909-37005931 ACATGGAAGTAGAGAGCAGAAGG + Intronic
1156533227 18:37838164-37838186 CCCAGGAAAGAGAGAGGAGATGG + Intergenic
1156887734 18:42155224-42155246 CCCTGGAGAGGGAGTGGAGAGGG - Intergenic
1157169569 18:45390099-45390121 CCCTGGAACTGCAGAACATAGGG + Intronic
1158086853 18:53661650-53661672 CCCTGGCAATGGAGAGAACATGG - Intergenic
1158163440 18:54512157-54512179 TCATGGACATGGAGAGTAGAAGG + Intergenic
1158623154 18:59049830-59049852 CCCTTCAGAAGGAGAGCAGAAGG - Intergenic
1160225895 18:77010167-77010189 CTCAGGAAATCGAGAGCAAAAGG + Intronic
1160533536 18:79578903-79578925 CCAGGGAACTGGAGAGCAGAGGG - Intergenic
1161347207 19:3774356-3774378 CCCTAGAGATGGAAAGGAGAGGG + Intergenic
1162190014 19:8937636-8937658 CCCTGGAACTAGTGACCAGAGGG + Exonic
1164839040 19:31378731-31378753 TCCTGGAAAAGAAGTGCAGAAGG + Intergenic
1165015851 19:32879545-32879567 CCCTGGGAATGGGGAGCAGCAGG + Intronic
1165015868 19:32879610-32879632 CCCTGGGAATGGGGAGCAGCAGG + Intronic
1165354490 19:35295365-35295387 CGCTGGAAAGGGAGAGGAGAGGG - Exonic
1165397475 19:35573534-35573556 CCTTGGAAATGGGGAGAAAAAGG - Intergenic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925641312 2:5988333-5988355 CCCTGGGAATGGAGAAGGGATGG - Intergenic
925754428 2:7120179-7120201 GCCTGGAGCTGGAGACCAGATGG + Intergenic
926083895 2:10009422-10009444 CCCTGGACAGGGAGAGCAGGAGG - Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
928792422 2:34973670-34973692 CCATGGAAATGGGGAGGAAAGGG + Intergenic
928899603 2:36303085-36303107 CCCTGGGAATGGAGCACACATGG - Intergenic
929498768 2:42471452-42471474 CCATGGAGATAGATAGCAGATGG + Intronic
929922476 2:46182408-46182430 CACTGGAGAGGGAGAACAGATGG + Intronic
931670084 2:64639911-64639933 GCCTGGAAGGGGAGGGCAGAGGG + Intronic
931925863 2:67071726-67071748 ACCTGGAAAAGGAGATCAGGTGG + Intergenic
934043123 2:88146641-88146663 CCCTGAAAATGGAGATGATAGGG - Intergenic
934847686 2:97672707-97672729 CCCTGGAAATGCTGCCCAGAGGG - Intergenic
934849450 2:97688123-97688145 CCCTGGAAATGCTGCCCAGAGGG - Intergenic
935128998 2:100247429-100247451 CCCAGGACATGGGGTGCAGACGG - Intergenic
935442542 2:103118390-103118412 TCATGGAGATAGAGAGCAGAAGG + Intergenic
935644112 2:105318885-105318907 CCCTGGAAGTGGAAGGGAGAGGG - Intronic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936023351 2:109012459-109012481 CCCTGGGATTGCAAAGCAGAAGG + Intergenic
936595198 2:113840846-113840868 ACCTGGAAAGGCAGAGGAGAGGG - Intergenic
938605067 2:132883682-132883704 CCAGGGAGATGGAAAGCAGAGGG - Intronic
938661776 2:133494362-133494384 ACATGGAAATGCAGAGGAGAAGG - Intronic
939086417 2:137724176-137724198 CCATGGAGATAGAGAGTAGAAGG + Intergenic
940314456 2:152312794-152312816 TCATGGAGATAGAGAGCAGAAGG - Intergenic
940429313 2:153569872-153569894 TCATGGACATAGAGAGCAGAAGG - Intergenic
941361481 2:164557207-164557229 CACACTAAATGGAGAGCAGAAGG + Intronic
941679148 2:168377972-168377994 TCCTGGAGATAGAGAGTAGAAGG + Intergenic
942298046 2:174536370-174536392 GCCAGGAACTGGTGAGCAGATGG + Intergenic
942732427 2:179074997-179075019 CCCTGGAAGAGGAGACCAGGAGG - Intergenic
942733532 2:179083986-179084008 CCATGGAGATAGAGAGTAGAAGG - Intergenic
942840946 2:180360061-180360083 CACAGGAAATGGAGAGAAGCAGG + Intergenic
943954134 2:194164179-194164201 CCCTGGAAAGGGTGAACAAAAGG - Intergenic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
944508112 2:200436156-200436178 CCCGATAAATGGAGAGCTGATGG + Intronic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
946246035 2:218387945-218387967 CCCTGGTCAAGGTGAGCAGAGGG + Exonic
946255443 2:218438485-218438507 CCCTGAAAAAGGAGATTAGATGG - Intronic
946309324 2:218873975-218873997 CTCTGGAAATGGTGAGGCGAGGG + Exonic
947307629 2:228764866-228764888 CCCAGGAAAGGGAGAGGAGCTGG + Intergenic
947623838 2:231607126-231607148 CCCAGGAACTGGCCAGCAGATGG - Intergenic
947717817 2:232350682-232350704 CCCAGAAAATGCAGAGCAGCGGG + Intergenic
948737362 2:240017664-240017686 CCCTGGACATGCTGAGCAGCGGG - Intronic
948947619 2:241229059-241229081 ACCTGGCAATGGACAGCAGGAGG - Exonic
1169213848 20:3782810-3782832 CCCTGGAGTTGGAGACCAGAAGG - Intergenic
1169587549 20:7103088-7103110 TCCTGGAAATAGAGAGTAGAAGG + Intergenic
1170096983 20:12656787-12656809 ACTTGGAAATGGAAAGCAGGAGG + Intergenic
1170172627 20:13432388-13432410 CTCTGGAAATGGAGTGTAAAAGG + Intronic
1170622033 20:18004391-18004413 TCCTGGAACTGGAAAGCAGTTGG - Intronic
1170818082 20:19731950-19731972 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1172902201 20:38343571-38343593 CCCTGGTAAGGTCGAGCAGAAGG - Intergenic
1173067576 20:39727961-39727983 CCCTGGAGATGCTGAGCAGGTGG - Intergenic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176301137 21:5099576-5099598 CCCTGGGAGTGGAGAGGAAACGG + Intergenic
1176448417 21:6841254-6841276 CCCAGGACATGGGGTGCAGAAGG + Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176826587 21:13706276-13706298 CCCAGGACATGGGGTGCAGAAGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177173668 21:17680922-17680944 GCCTATAACTGGAGAGCAGAAGG + Intergenic
1177582491 21:23044130-23044152 GCCTGGAAATGGAGCTCAGATGG - Intergenic
1179367147 21:40769112-40769134 CCTTGGGAAGTGAGAGCAGAGGG - Intronic
1179536729 21:42057673-42057695 GCCTGGAAATGTGGAGCAGCCGG + Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179855892 21:44162322-44162344 CCCTGGGAGTGGAGAGGAAACGG - Intergenic
1179893462 21:44349412-44349434 CCCTGGACATGGAGGCCAGCAGG + Intergenic
1181041437 22:20194442-20194464 CCCGGGAAAGGCAGGGCAGAGGG - Intergenic
1182181113 22:28349110-28349132 CTTTGGAAAAGCAGAGCAGAAGG + Intronic
1182789404 22:32937155-32937177 ACGTGGAAATGGAGAGATGATGG + Intronic
1182838233 22:33361938-33361960 ACCAGGAAAGGGAAAGCAGAGGG - Intronic
1183091134 22:35522982-35523004 CCCTGGAAATACAAAGAAGATGG + Intergenic
1183273738 22:36878199-36878221 CCCAGGAAAAGGGGAGCAGTGGG - Intergenic
1183482811 22:38074471-38074493 CCTCTGAAATGGAGAGCGGACGG - Intronic
1184406603 22:44304142-44304164 GCCTGGTCAGGGAGAGCAGAGGG + Intronic
1184569159 22:45310961-45310983 CACTGGAAATAGAGATGAGACGG + Intronic
1184883997 22:47330975-47330997 CCCTGGAAATGCAGAGATGGTGG + Intergenic
949097769 3:106438-106460 CCCAGAACATGAAGAGCAGAAGG - Intergenic
949231683 3:1757363-1757385 GCCTGGACATGGAGTGAAGAGGG - Intergenic
949474669 3:4432042-4432064 ACCTAGAAAGGGACAGCAGAGGG - Intronic
950030544 3:9849741-9849763 CCCTGGGAATGGGGAGAAAAAGG - Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
950790028 3:15464167-15464189 CCCTAGACATGGACAGGAGAGGG + Intronic
950863220 3:16168876-16168898 CCTTGGGTATGGAGAGCAGGTGG + Intergenic
951032002 3:17892994-17893016 TCATGGACATAGAGAGCAGAAGG - Intronic
951857549 3:27214590-27214612 CTCTGGAAATGGTGAGGAGGTGG - Intronic
952298630 3:32084544-32084566 AACTGGAAATGGAGAAGAGAGGG + Intergenic
952423764 3:33153866-33153888 CCACAGAAATGGAGACCAGACGG + Exonic
952433668 3:33250091-33250113 CCATGGAGATAGAGAGCAGAAGG - Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953125749 3:40090341-40090363 CCTTGGAATTGGAGAGCATTAGG + Intronic
953955044 3:47225374-47225396 TTCTGGAAATAGAGAGCAAAAGG + Intergenic
954429510 3:50462752-50462774 AGCTGGAAATGGAGAGGAGGGGG + Intronic
955614202 3:60788625-60788647 CCCTGGAGATGCATAGCACAGGG - Intronic
957040953 3:75335193-75335215 ACCTTGAAAAGGAGAGAAGAAGG + Intergenic
957054144 3:75431437-75431459 CCCTTGGAAAGGAGGGCAGAGGG + Intergenic
958049147 3:88322069-88322091 CCCTGGCTATGGATAGGAGAGGG + Intergenic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
960143873 3:114178250-114178272 CCCTGGCAATTCAGAGCTGAAGG - Intronic
960427628 3:117528351-117528373 TCCTGGAGATGGAGAGTAGAAGG - Intergenic
960801885 3:121548229-121548251 CTCTGAAAATGGAGAATAGAAGG + Intergenic
961920595 3:130421339-130421361 CCCTGGAGATGCGGGGCAGAAGG + Exonic
962089704 3:132230381-132230403 CACTGGAACTGGGGAGGAGAGGG - Intronic
963493321 3:146028787-146028809 CCCTGGGAAGGGAGAGCATCAGG - Intergenic
964180155 3:153874022-153874044 CTCTGGAGATAGAGAACAGAAGG + Intergenic
965610123 3:170535060-170535082 CCATGGAAAAGGAGAGGAGAAGG - Intronic
965888562 3:173479707-173479729 CACAGGAAATGGAGATGAGATGG + Intronic
966037765 3:175441121-175441143 ACCTGGATATGGAGAGCCAATGG - Intronic
966301920 3:178488669-178488691 CCCTGAAGATGTACAGCAGATGG - Intronic
966419786 3:179726209-179726231 CCCAGGAAAAAGACAGCAGAAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967215807 3:187209239-187209261 CCTATGAAATGGAAAGCAGAGGG - Intergenic
967494003 3:190122469-190122491 CCCCTGCAATGGTGAGCAGAGGG + Intergenic
967954665 3:194869076-194869098 CGCTGGAGATGGGGAGAAGAAGG + Intergenic
969276924 4:6142036-6142058 CCCTGGAAAAGCAGCCCAGAAGG - Intronic
969302642 4:6306222-6306244 CGCTGGAAAAGGTGAGGAGATGG + Intergenic
969325998 4:6444204-6444226 CCCCGAAAATGGAAATCAGATGG + Intronic
969410152 4:7022682-7022704 TCATGGAAATGCAGAGCAGGGGG + Intronic
970583249 4:17492340-17492362 CCTGGGAAATGGGGAGAAGATGG + Exonic
970632789 4:17970313-17970335 GCTTGGAAATGTAGAGCACAAGG - Intronic
970687613 4:18586556-18586578 CCCAGGAGATGGAGAGTGGAGGG + Intergenic
971162788 4:24150912-24150934 GCGTGGAAATAGAGAGGAGAGGG - Intergenic
973754226 4:54057450-54057472 CCCTGGATCTGGAGAACAGCAGG - Intronic
975280028 4:72551120-72551142 CCCTTGAAATGGTCAGCCGATGG - Intronic
975877556 4:78860952-78860974 GCCTGGAAAATGAGGGCAGAAGG - Intronic
977276013 4:94978109-94978131 CCTTGGAACTGGACAGCATATGG - Intronic
978026554 4:103882610-103882632 CCATGGAGATAGAGAGTAGAAGG - Intergenic
979427593 4:120586620-120586642 CCATGGAGATAGAGAGTAGAAGG + Intergenic
979700786 4:123665574-123665596 CCATGGAAAAGAAGATCAGAGGG + Intergenic
980637250 4:135523525-135523547 TCATGGACATAGAGAGCAGAAGG + Intergenic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
983078134 4:163350779-163350801 CACTGGAAGGGGAGAACAGATGG - Exonic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983631313 4:169852405-169852427 TCCTGTAAGTGGAGAGCAGAGGG - Intergenic
984239259 4:177197944-177197966 TCATGGACATGGAGAGTAGAAGG - Intergenic
984737579 4:183125006-183125028 CCCTGGCAATGGTGAGCACTGGG - Intronic
984883548 4:184430405-184430427 GCCAGGGAATGAAGAGCAGAGGG - Intronic
985843322 5:2325879-2325901 CGCTGGAACTGGAGAGGAAAGGG - Intergenic
987162867 5:15162927-15162949 TCCTGGAAATCTAGAGGAGATGG + Intergenic
987432424 5:17852462-17852484 CCATGGAAATTGAGACCATATGG - Intergenic
988128630 5:27074852-27074874 CCCTGAAAATGAGGAGGAGAAGG + Intronic
988180923 5:27792061-27792083 CCCTGAAAACAGAAAGCAGACGG + Intergenic
988207080 5:28152351-28152373 TCATAGAAATGGAGAGTAGAGGG - Intergenic
988249728 5:28740942-28740964 TCATGGACATAGAGAGCAGAAGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
989111600 5:37912204-37912226 CCATGGAGATAGAGAGTAGAAGG + Intergenic
989436457 5:41418913-41418935 CCTTGTAAATGGAAAGCAGTAGG + Intronic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
990087599 5:51998026-51998048 CCATGATAATGCAGAGCAGATGG - Intergenic
990521192 5:56582985-56583007 CCCTGGGAAAGGGGAACAGATGG + Intronic
990995267 5:61726753-61726775 CTCTGGAAGTGGGGAGCAAAGGG + Intronic
991438332 5:66618882-66618904 CCCTGGAAAGGGAGAGAGGCAGG - Intronic
991538208 5:67696649-67696671 CCCTGGGAATCGGGAGCAGATGG + Intergenic
994122040 5:96125751-96125773 TCCTGGAAAAGTTGAGCAGATGG - Intergenic
994265433 5:97710599-97710621 CCATGGAGATAGAGAGTAGAAGG + Intergenic
994660511 5:102648357-102648379 TCATGGACATGGAGAGTAGAAGG + Intergenic
995154058 5:108889510-108889532 TCCTGGAGATAGAGAGTAGAAGG + Intronic
995715953 5:115082120-115082142 CCCTGGAGATGGAGATCACTGGG - Intergenic
995980234 5:118093102-118093124 CCCAGGAATTCGAGATCAGAAGG + Intergenic
996339006 5:122415568-122415590 AGTTGGAAATGGAGAGAAGAGGG + Intronic
996533491 5:124551212-124551234 CCCCAAAAATGGAGGGCAGAGGG + Intergenic
996688280 5:126309362-126309384 TCATGGAGATAGAGAGCAGAAGG + Intergenic
997468037 5:134101202-134101224 CCCTGGAAACTGAGAGGAGCAGG - Intergenic
997505196 5:134411647-134411669 CCATGGAGAGGGAGAGCAGCTGG + Exonic
998016143 5:138733908-138733930 CCCTGGAAGGGCAGAGCAGTCGG + Intronic
998818903 5:146040860-146040882 CCCTGGCAGGGCAGAGCAGAGGG - Intronic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001446209 5:171785879-171785901 CCCAGCAAGTGGACAGCAGAAGG + Exonic
1001814087 5:174653358-174653380 TCATGGACATAGAGAGCAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002312991 5:178325838-178325860 CACTGGGAATGGAGAGCATGTGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002917431 6:1540596-1540618 CCCTGGGTATGCAGAGCACAAGG + Intergenic
1003236020 6:4295687-4295709 GCCGGGAAATGCAGAGTAGAGGG + Intergenic
1003491593 6:6627144-6627166 CCCTGGGAGGGGAGAGCAGCTGG - Intronic
1004456468 6:15796323-15796345 GCCTGGAGAGGGAGAGCACAGGG + Intergenic
1005410349 6:25538843-25538865 CCATGGAAATGGAGAGGGGCTGG + Intronic
1005781988 6:29201879-29201901 CCCTGGCTATGGAGAGGAGCGGG + Intergenic
1005801171 6:29426833-29426855 AGCTGGGAATGGACAGCAGAGGG + Exonic
1005928859 6:30466068-30466090 CCCTAGGGATGGAGAACAGAAGG + Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1007169434 6:39852330-39852352 CCCTGGACAGGGAGAGGAGAAGG - Intronic
1007298147 6:40844399-40844421 CACAGGAAATGGAGAACAGCAGG + Intergenic
1007552126 6:42738242-42738264 CCATGGAAATAGAGAGTAGAAGG + Intergenic
1007571622 6:42895749-42895771 CCCTGGAAATGGGGTGAAAAGGG - Intergenic
1007693872 6:43719524-43719546 CCCTGGGAATGGTGGGGAGATGG + Intergenic
1007727718 6:43926742-43926764 CCGGGGAAATGGAAAGCAGGAGG + Intergenic
1009447966 6:63765826-63765848 TCATGGAGATAGAGAGCAGAAGG - Intronic
1011123398 6:83979841-83979863 TCCTGGAGATAGAGAGAAGAAGG - Intergenic
1011659138 6:89579039-89579061 CTCTGGAAATGGTGTGCAGGAGG - Intronic
1012028857 6:94032361-94032383 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1013032383 6:106346588-106346610 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1013417614 6:109938861-109938883 CCATGGAAATGGGGTGGAGAGGG + Intergenic
1014159694 6:118153875-118153897 GTCTGGGAATGGACAGCAGATGG + Intronic
1016007992 6:139108719-139108741 CCCTGCACATGGAGAGAAGAAGG - Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016320251 6:142835299-142835321 GCCTGGACATTGAGTGCAGATGG - Intronic
1016555067 6:145327268-145327290 CCCTTGGAATTGAGAGTAGACGG + Intergenic
1016894473 6:149038649-149038671 CCCTGGAAATGGGGAGGAAGAGG - Intronic
1018391865 6:163347001-163347023 CCCTGGACAAGGAGGGCACATGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018690878 6:166342932-166342954 GCCTGGAATCGGAGAGCGGAGGG + Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1019836147 7:3386624-3386646 CCCTGTAAATGGTGAACAGGTGG - Intronic
1020192176 7:6008903-6008925 CCCTGGAAATGGGGGGAACATGG - Intronic
1020532055 7:9350443-9350465 CCATGAAAATGGAAAGCAGAGGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022415377 7:30172598-30172620 AACTGGAAAAGGAAAGCAGATGG - Intergenic
1022472202 7:30688873-30688895 CCCTGGAGTTGGAAAGCTGAGGG + Intronic
1023109073 7:36792030-36792052 CCATGGGAATGAAGAGCAAAAGG - Intergenic
1023203075 7:37719935-37719957 CTTTGGAAATGGGGAGCAGCAGG + Intronic
1024619721 7:51147036-51147058 CCCTGCATAGGGACAGCAGAAGG + Intronic
1026091186 7:67302290-67302312 CCCTGGAAATGGGGGGAACATGG - Intergenic
1026150296 7:67782681-67782703 ACCTGGAAATGGGAAGCTGATGG - Intergenic
1026294936 7:69043092-69043114 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1026447756 7:70500355-70500377 CCCAGGAAAAGGAATGCAGAAGG + Intronic
1026745243 7:73006237-73006259 CCCTGGAAATGGGGGGAACATGG + Intergenic
1026923081 7:74170648-74170670 CCCAGCAAATGGAGACCAGCCGG - Intergenic
1027031353 7:74890909-74890931 CCCTGGAAATGGGGGGAACATGG + Intergenic
1027098499 7:75358859-75358881 CCCTGGAAATGGGGGGAACATGG - Intergenic
1027298033 7:76798683-76798705 GCCTGGATATGAAGAGTAGAGGG - Intergenic
1029399607 7:100335753-100335775 CCCTGGAAATGGGGGGAACATGG - Intergenic
1029488773 7:100859029-100859051 CCCTGGAGAGGGGGAGCAGAGGG - Exonic
1029608737 7:101615334-101615356 GCCTGGAGAAGGAGAGGAGAGGG - Intronic
1030077860 7:105751842-105751864 CCATGGAAAGGCAGAGCTGACGG - Intronic
1031924835 7:127629451-127629473 CCCTGCAAATGCAGAGCACTGGG - Intergenic
1033920802 7:146388789-146388811 CCATGGACATAGAGAGTAGAAGG - Intronic
1035602880 8:907521-907543 GCCTGGAAATGGAGGGCTGTTGG - Intergenic
1035760800 8:2067595-2067617 CCCAGGAAATGGAGACAAGAGGG - Intronic
1036477800 8:9109563-9109585 CCCAGGAAGGGGAGAACAGAGGG - Intronic
1038529034 8:28302137-28302159 TCATGGACATGGAGAGTAGAAGG - Intergenic
1039236446 8:35507563-35507585 TCATGGAGATAGAGAGCAGAAGG + Intronic
1039983071 8:42425506-42425528 CCGTGTAGTTGGAGAGCAGATGG - Intronic
1040526030 8:48226014-48226036 CCCTTGATCTGGAGAGCACATGG + Intergenic
1040867317 8:52061374-52061396 TCATGGACATGGAGAGTAGAAGG - Intergenic
1040915563 8:52564353-52564375 CCCTGGAAAAGGAGGTCCGAGGG - Intronic
1041529573 8:58850001-58850023 CCCTGGAAATGGTCAGCTAAAGG + Intronic
1041981022 8:63859748-63859770 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1042298780 8:67252419-67252441 AGCTGGAAATGGAAAGGAGATGG - Intronic
1042494835 8:69444366-69444388 GCCTGGAAAGGAAGAGGAGAGGG + Intergenic
1042955020 8:74240438-74240460 TCATGGAGATGGAGAGTAGAAGG - Intronic
1044394658 8:91696548-91696570 TCATGGACATGGAGAGTAGAAGG - Intergenic
1044620752 8:94188563-94188585 TCCTGGAAATGTAGTGGAGAAGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045047277 8:98291458-98291480 CCATGGAAATTCAGAGCAAAGGG - Intronic
1047332516 8:123904632-123904654 CACTGGAAGTGTTGAGCAGAGGG + Intronic
1047741446 8:127810090-127810112 CTCTGGAAAGGGAGAGGAGCAGG + Intergenic
1047973444 8:130106914-130106936 CACTGGAAATGTAAAGAAGAAGG - Intronic
1048907637 8:139103883-139103905 CCCTGGAGATGGATAGCTGAAGG + Intergenic
1049069979 8:140349033-140349055 CCTTGGCAAGGGAGAGGAGAGGG + Intronic
1049202401 8:141346734-141346756 CCTTGCAGATGGAGTGCAGATGG - Intergenic
1049748638 8:144273439-144273461 CACAGGAAAGGGACAGCAGAGGG + Intronic
1050055734 9:1651969-1651991 CCCTAGAATAGGATAGCAGAAGG - Intergenic
1050121134 9:2308375-2308397 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1050278876 9:4029633-4029655 CCATGGAAATGGAGAATAGAAGG - Intronic
1050356699 9:4790869-4790891 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1050963211 9:11764888-11764910 TCATGAAAATAGAGAGCAGAAGG + Intergenic
1051367520 9:16331739-16331761 CCAAGGAAAAGCAGAGCAGAGGG + Intergenic
1051704864 9:19866872-19866894 CCATGGATATAGAGAGTAGAAGG + Intergenic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1052208564 9:25872672-25872694 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1053105232 9:35403225-35403247 CCCTGGTACTGGGGAGCACAAGG + Exonic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055771125 9:79718027-79718049 CCCTGGAAATGAACTGGAGATGG + Intronic
1056617901 9:88184198-88184220 CCCTGGATAAGGAGAGGAGTGGG + Intergenic
1056711754 9:88997372-88997394 TCCCGGGAATGGAGAGAAGAGGG - Exonic
1056893819 9:90522335-90522357 CCCCCTAAAAGGAGAGCAGAAGG - Intergenic
1056932791 9:90892726-90892748 CCTTGCAAATGGAGAGAAGTTGG + Intronic
1057045927 9:91886326-91886348 CCCTGGAAATGGCGAGGGGAGGG - Intronic
1058811020 9:108639608-108639630 GTCTGGAAAGGGAGAGGAGAGGG - Intergenic
1059446578 9:114341952-114341974 CCCTGGTCAAGGAGAGCTGAGGG + Intronic
1059540528 9:115125904-115125926 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1059837958 9:118178332-118178354 CCCTTGACATGGGGAGCAGATGG + Intergenic
1060030476 9:120210701-120210723 CCCTGTTAATGGACAGCACAAGG + Intergenic
1060921847 9:127425976-127425998 ACCTGGGAAAGCAGAGCAGATGG + Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061824351 9:133248542-133248564 CCCTGAGAATGCAGTGCAGAAGG + Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062581556 9:137231221-137231243 CCCTGGTGATGGGGAGCAGGTGG - Intronic
1203520774 Un_GL000213v1:43264-43286 CCCAGGACATGGGGTGCAGAAGG - Intergenic
1185949541 X:4416206-4416228 CCCAGGAATTGGGGAGAAGAAGG - Intergenic
1187095673 X:16145456-16145478 TCATGGACATGGAGAGTAGAAGG + Intronic
1187102106 X:16204192-16204214 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1187843943 X:23516666-23516688 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1188323267 X:28766719-28766741 TCATGGACATGGAGAGTAGAAGG - Intronic
1188648949 X:32606207-32606229 TCATGGAAATAGAGAGTAGAAGG - Intronic
1189220723 X:39369407-39369429 CCCAGGAAATGGGGAGGACATGG + Intergenic
1189510289 X:41655288-41655310 TCCTGCAAAGGGCGAGCAGATGG - Intronic
1189750634 X:44217654-44217676 CCATGGAGATAGAGAGTAGAAGG + Intronic
1189868313 X:45354448-45354470 CCCTGGAGATAGAGAGTAGAAGG - Intergenic
1191189025 X:57646153-57646175 TCATGGAGATAGAGAGCAGAGGG + Intergenic
1191672576 X:63762158-63762180 ACCTGGACATGGAGGTCAGAGGG - Intronic
1191924016 X:66289094-66289116 TCATGGACATAGAGAGCAGAAGG - Intergenic
1192036717 X:67570963-67570985 CACAGGAAATGGAGAGGTGAAGG + Intronic
1192210914 X:69127171-69127193 CCCTGGCAGTGGAGAGGGGAGGG - Intergenic
1192417116 X:70991373-70991395 CCCTGGAGATAGAGAGTAGAAGG - Intergenic
1193036638 X:76958192-76958214 CCCTGGAAAATAACAGCAGACGG + Intergenic
1193359879 X:80569216-80569238 CCATGCAAATGGAAAACAGAAGG - Intergenic
1193500604 X:82269584-82269606 CCAGGGAAATGGAGAGCATCAGG - Intergenic
1193707275 X:84837128-84837150 CCATGGAGATAGAGAGCAGAAGG + Intergenic
1193842392 X:86422848-86422870 TCATGGAGATGGAGAGTAGAAGG - Intronic
1193908442 X:87271651-87271673 TCCTGGAGATAGAGAGTAGAAGG + Intergenic
1194419484 X:93655889-93655911 CCATGGAAATAGAGAATAGAAGG + Intergenic
1194770246 X:97894362-97894384 GCCTGGATATAGAGAGTAGAAGG - Intergenic
1195079759 X:101359529-101359551 TCATGGAAATGGAGAGTAGCAGG + Intronic
1195304303 X:103564261-103564283 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1195312866 X:103650270-103650292 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1195415842 X:104618785-104618807 GCCTGGACATGGAGTGCAGGGGG + Intronic
1196968436 X:121083641-121083663 CCTTGGAAATTGAGAGCAATTGG - Intergenic
1197408916 X:126091921-126091943 TCATGGAAATGGAGAGTAGAAGG + Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197623043 X:128772750-128772772 GCATGGAGATAGAGAGCAGAAGG - Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198316013 X:135467201-135467223 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1198402406 X:136280548-136280570 CCCAGGAAAAGGACATCAGAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198488847 X:137117661-137117683 TCATGGAAATAGAGAGTAGAAGG + Intergenic
1198514660 X:137393644-137393666 TCATGGAAATAGAGAGTAGAAGG - Intergenic
1199099230 X:143779471-143779493 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199195421 X:145023807-145023829 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199252473 X:145679161-145679183 CACTGGATATGGAGATGAGAAGG - Intergenic
1199370031 X:147036433-147036455 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic