ID: 1148857270

View in Genome Browser
Species Human (GRCh38)
Location 17:50585620-50585642
Sequence CAGTGTGCCCAGTGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 3, 2: 6, 3: 38, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148857264_1148857270 0 Left 1148857264 17:50585597-50585619 CCTGGGGGCACCATGACACCTAG 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG 0: 1
1: 3
2: 6
3: 38
4: 405
1148857260_1148857270 16 Left 1148857260 17:50585581-50585603 CCTCTGATTAGGAGGCCCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG 0: 1
1: 3
2: 6
3: 38
4: 405
1148857265_1148857270 -10 Left 1148857265 17:50585607-50585629 CCATGACACCTAGCAGTGTGCCC 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG 0: 1
1: 3
2: 6
3: 38
4: 405
1148857263_1148857270 1 Left 1148857263 17:50585596-50585618 CCCTGGGGGCACCATGACACCTA 0: 1
1: 0
2: 0
3: 17
4: 98
Right 1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG 0: 1
1: 3
2: 6
3: 38
4: 405
1148857255_1148857270 27 Left 1148857255 17:50585570-50585592 CCTTGGCACTGCCTCTGATTAGG 0: 1
1: 0
2: 6
3: 20
4: 162
Right 1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG 0: 1
1: 3
2: 6
3: 38
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148857270 Original CRISPR CAGTGTGCCCAGTGGGCAGG AGG Intronic
900185349 1:1330797-1330819 CAGTCAGGCCAGTGGGCAGCCGG - Intergenic
900298683 1:1965708-1965730 GGGTGTCCCCAGTGGGCAGGTGG + Intronic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
900948638 1:5845167-5845189 CCGTGTTCCCAGCGGGCAGCCGG + Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901025305 1:6275982-6276004 CAGTGTGCCCAGGAAGCAGTGGG + Intronic
901066812 1:6498181-6498203 CAGTGTGCAGGGTGGGCTGGGGG - Intronic
901494941 1:9615490-9615512 CCCAGTGCCCAGCGGGCAGGAGG + Intergenic
901797829 1:11691095-11691117 AAGTGCGCAGAGTGGGCAGGCGG - Intronic
902111808 1:14085436-14085458 CAGGGTTGCCAGTGGTCAGGGGG - Intergenic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
903319746 1:22535568-22535590 CTGTGTGCCCCCTGGGCTGGAGG - Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903607398 1:24584950-24584972 CTGTGTGCCCAGTGAGTGGGTGG + Intronic
904271755 1:29354769-29354791 CAGTGTGCAGAGTGGGTTGGAGG - Intergenic
904321196 1:29698733-29698755 CACTGTTCCCACTGTGCAGGTGG - Intergenic
904597529 1:31656286-31656308 CAGGAAGGCCAGTGGGCAGGGGG - Intronic
904684535 1:32250962-32250984 CTTTGGGCCCAGTGAGCAGGGGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905516339 1:38564705-38564727 CACTGTGCCCAGGGGTCATGGGG + Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906908966 1:49925738-49925760 CGGTGCTCCCCGTGGGCAGGTGG + Intronic
907020327 1:51060494-51060516 CAGTGTGACGAGTGGGGTGGAGG - Intergenic
907414272 1:54303370-54303392 CAGTCAGCCCAGGGGGCAGGGGG + Intronic
907871437 1:58447074-58447096 CTGAGTGCTCAGTGGCCAGGTGG + Intronic
908339061 1:63157838-63157860 CACAGTGCCCAGTGGGAAGTTGG + Intergenic
908979803 1:69942117-69942139 GAGTGGGCACAGTGGGCAGTAGG + Intronic
909000829 1:70215739-70215761 CAGGGTTCCCAGTGGGTAGCGGG + Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
912379434 1:109239420-109239442 CAGCGTACACAGTGTGCAGGAGG + Intergenic
912552539 1:110493486-110493508 CAGTGAGCCCAGAGGCCATGAGG - Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915313335 1:155015392-155015414 CAGTGGGGGCAGTGGGCCGGGGG + Exonic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
917098296 1:171421858-171421880 CAGTCCTCCCAGTGCGCAGGTGG + Intergenic
918251494 1:182707327-182707349 CAGTGTTCTTAGTGGGCAGAAGG - Intergenic
920349490 1:205328541-205328563 AAGTGTGCCCAGGAGGGAGGTGG + Intergenic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921585097 1:216936988-216937010 AAGTGTGGCCAGTCTGCAGGGGG - Intronic
922033575 1:221826927-221826949 CAGGGAGCCCAGTGGTCAGCTGG + Intergenic
922864564 1:228848510-228848532 CACTGTGCCCAGTTGGCTGGGGG - Intergenic
922929051 1:229374655-229374677 GAGTCAGCACAGTGGGCAGGAGG - Intergenic
924214664 1:241808523-241808545 GAATGTTCCCAGTGGCCAGGAGG - Intergenic
924732912 1:246728493-246728515 AAGTGTGACCAGTTAGCAGGGGG - Intronic
1063432043 10:5999506-5999528 CAGGGAGCCCTGTGGGGAGGGGG + Intergenic
1063485092 10:6412760-6412782 CAGTGTGCACATTGGTCAGGAGG - Intergenic
1065502021 10:26392019-26392041 CAGTCTGCCCGGTGAGCAGGTGG - Intergenic
1066454851 10:35564326-35564348 CACTGGGACCTGTGGGCAGGCGG - Intronic
1067077808 10:43198012-43198034 TAATGTGCCCGTTGGGCAGGTGG + Exonic
1067143774 10:43678771-43678793 CAGTGAACACAGTGGGCAGGAGG - Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067556382 10:47276235-47276257 CAGTCTCCCCAGGGAGCAGGAGG + Intergenic
1069583542 10:69581417-69581439 GAGTGTGGGCAGTGGGTAGGGGG - Intergenic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1070722727 10:78768024-78768046 CAGGTGGCCCTGTGGGCAGGAGG + Intergenic
1070757352 10:79001641-79001663 CAGTGTCCCCAGCAGGCAGGAGG + Intergenic
1071321778 10:84467377-84467399 AAGTGTGTCCAGTGGGCAACTGG - Intronic
1073045385 10:100634610-100634632 CACAGTGCCCGGTGGGCACGGGG + Intergenic
1075344596 10:121673021-121673043 GAGTTTGCCCAGAGGGCAAGAGG + Intergenic
1075626124 10:123965633-123965655 GAGGGTGCCCAGGGGGCATGTGG - Intergenic
1075897268 10:126007878-126007900 CAGTGTGCCCAGTAATCAGATGG - Intronic
1076122850 10:127950103-127950125 CAGTGTGCCCCATGAGGAGGTGG + Intronic
1076700840 10:132271827-132271849 CAGTGTGCCCAGGAGGCCGCAGG - Intronic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1076963407 10:133785926-133785948 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1077113132 11:870609-870631 CACTGTCCCCAGTGGTCTGGGGG + Intronic
1077252511 11:1566830-1566852 CAGACTGCCGGGTGGGCAGGTGG + Intronic
1077295298 11:1823639-1823661 CAGCATACCCAGGGGGCAGGTGG + Intergenic
1077299820 11:1841746-1841768 CAGTGTGGTCAGTGGCCAGCGGG + Intergenic
1078628331 11:12978989-12979011 CAGTATCTACAGTGGGCAGGTGG - Intergenic
1081522985 11:43900835-43900857 CAGTGAACCCAGTGCCCAGGAGG + Intronic
1081701405 11:45155085-45155107 GAGTGGGCCCAGCAGGCAGGAGG + Intronic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1082204380 11:49414668-49414690 CAGTGTGGCTTGTGGGTAGGAGG - Intergenic
1083615401 11:64023674-64023696 GAATGGGCCCAGTGGGAAGGAGG - Intronic
1084268432 11:68016744-68016766 CAGGGAGCCCAATGGGCTGGGGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085299427 11:75449713-75449735 CAGTGTCCCCAGTTGGCAGATGG - Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1087380415 11:97398424-97398446 CAGTATTCCCAGTGGGCCTGTGG - Intergenic
1087781569 11:102306364-102306386 CAGTGTGCCCTGGGGAAAGGGGG + Intergenic
1089465092 11:118679784-118679806 CACTGTGCCCTGAGAGCAGGAGG - Intergenic
1089769901 11:120795323-120795345 CAGTTTACCCAGGGAGCAGGAGG + Intronic
1091785582 12:3241740-3241762 CAGTGTGCCCAGTGGGGCTGGGG + Intronic
1092162129 12:6321395-6321417 CAGTGTGCTGGGTGGGCTGGAGG + Intronic
1092306896 12:7310618-7310640 CATTGTGGCCAGTGAGGAGGTGG + Exonic
1092433961 12:8431510-8431532 CAGTGAGCCCAGGGGACCGGCGG + Intergenic
1093705732 12:22273222-22273244 AAGTGTGCCAAACGGGCAGGTGG - Intronic
1094568151 12:31618388-31618410 GAGTGAGACCAGTGGGCTGGGGG + Intergenic
1096860962 12:54527780-54527802 AAGTTTGCCCAGAGGTCAGGAGG + Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1099126971 12:78773272-78773294 CAGTGTGCCAATTGGCCAAGTGG + Intergenic
1100281313 12:93120808-93120830 CAGTGTGTCAAGTAGGGAGGAGG - Intergenic
1102569401 12:113818381-113818403 TACTGGGGCCAGTGGGCAGGGGG + Intronic
1102873254 12:116430495-116430517 CAGTGAGAAAAGTGGGCAGGAGG - Intergenic
1103593656 12:122010012-122010034 CAGTCTGGCCGGTGGGCTGGGGG - Intergenic
1104122153 12:125809812-125809834 CAGTGTGCCTAGTAGACAGGAGG - Intergenic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1104836915 12:131797642-131797664 CAGTGTGCCTGGTGGGCATCAGG - Intronic
1104875954 12:132034958-132034980 CGGTGAGCCCAGTGGACAGGCGG + Intronic
1104947697 12:132423960-132423982 CCGCGTGCCCCGCGGGCAGGAGG - Intergenic
1105209596 13:18249992-18250014 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1105278675 13:18950738-18950760 GAGCTTGCTCAGTGGGCAGGTGG - Intergenic
1106079075 13:26485661-26485683 CAGTGTGTCCATTGTACAGGGGG - Intergenic
1107531431 13:41285776-41285798 CAGTTTTCCCATTGGGCTGGAGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107829632 13:44362877-44362899 CAGAGTGCCCAGAGAACAGGAGG + Intergenic
1109293070 13:60498929-60498951 CAGTGGGTCCAGTGGGTACGCGG + Intronic
1112308139 13:98293792-98293814 CTTTCTTCCCAGTGGGCAGGAGG - Intronic
1112437328 13:99399689-99399711 CAGAGTTCCCAGGGGGCAGTAGG - Intergenic
1113468331 13:110527389-110527411 CAGTGTGCCCTTTGGGGATGTGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113989836 13:114352762-114352784 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1118610142 14:67533354-67533376 CCGTGTGCCCAGTGCGCGGCGGG + Exonic
1119188087 14:72658870-72658892 AAGTGTGCCCAGTAGGCACATGG + Intronic
1119706571 14:76786627-76786649 CAGGGCTCCCAGTGGGCATGTGG + Intergenic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120056642 14:79932055-79932077 TAGTGGGCTCAGAGGGCAGGGGG - Intergenic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1121302192 14:92880725-92880747 CAATGTGACCAGGAGGCAGGTGG - Intergenic
1121317554 14:92971185-92971207 CAGAGTGCCCAGTCGGGTGGGGG - Intronic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1122328109 14:100894880-100894902 CACTGCCCCCAGTGGGCAGTGGG + Intergenic
1122794873 14:104201108-104201130 CAGTGCACCCAGTGGGTGGGAGG + Intergenic
1122970546 14:105150440-105150462 CTGGGTGCCAGGTGGGCAGGCGG - Intronic
1123479263 15:20616039-20616061 CATTGTCCCCAGGGAGCAGGGGG + Intergenic
1123501871 15:20893665-20893687 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123559124 15:21467364-21467386 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123595355 15:21904645-21904667 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123638750 15:22384346-22384368 CATTGTCCCCAGGGAGCAGGGGG - Intergenic
1124086954 15:26559945-26559967 GACTGTGGCCACTGGGCAGGTGG + Intronic
1124220022 15:27843310-27843332 AAGTGTGCTGAGTGGGCAGCAGG - Intronic
1124802174 15:32843665-32843687 CAATGAGCTCAGTGGGCAGACGG + Intronic
1126826243 15:52552279-52552301 CACTGTGCCCAGTCTGAAGGGGG - Intronic
1129226410 15:74172957-74172979 CTGGGTGCCCAGTGGGCAGTGGG + Intergenic
1129296815 15:74604328-74604350 CGGTCTGCCCTGTGGGCAGAGGG + Intronic
1129425567 15:75460047-75460069 CAGTCTGCCAAGTGTTCAGGAGG - Intergenic
1129889943 15:79065394-79065416 CAGGGATGCCAGTGGGCAGGTGG + Intronic
1129976403 15:79826048-79826070 AAGTGTGCCCAGTGGTAAAGGGG - Intergenic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1130987168 15:88852091-88852113 CAGTGTGCCTGGTGGGGCGGGGG + Intronic
1132019479 15:98348046-98348068 AGGTGTGCCCAGGAGGCAGGTGG + Intergenic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1132973735 16:2701393-2701415 CAGGGTCCCCAGTGGTCAGCAGG + Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133803420 16:9103799-9103821 GAGTGCAGCCAGTGGGCAGGTGG + Intronic
1133820396 16:9231259-9231281 CAGTGAGCCCAGTGTGGTGGGGG - Intergenic
1134090114 16:11387047-11387069 CCCTGTGCCCAGGAGGCAGGGGG + Intronic
1135231403 16:20711552-20711574 CATTGTGGCCAGTGAGGAGGTGG + Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1138245444 16:55463663-55463685 CACTGTCCTCAGTGGGGAGGAGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1139357769 16:66377456-66377478 CAGTGGGCCCAGAGGTCAGCTGG + Intronic
1139710287 16:68770772-68770794 CAGTGTGTGGAGTGGGCAAGAGG + Intronic
1140001507 16:71029874-71029896 CTGTGAGCCCAGAAGGCAGGGGG + Intronic
1140181250 16:72721165-72721187 CTGTATGCCCAGTGGTGAGGGGG - Intergenic
1140181402 16:72722681-72722703 CAGTGCACCCAGTGGGGGGGAGG + Intergenic
1141469035 16:84226072-84226094 CGGTGTGCCCAGGGCCCAGGGGG - Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142225770 16:88876994-88877016 CAGTGGGCCAGGTGGGCTGGGGG + Exonic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142808185 17:2382624-2382646 CTGTGTTCCCAGTGGGCACAGGG + Intergenic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1144129172 17:12229287-12229309 GAGTGTGCTCAGTTGCCAGGAGG + Intergenic
1144772272 17:17766502-17766524 CAGGGTGCTCTCTGGGCAGGAGG + Intronic
1144776997 17:17789877-17789899 GAGTGAGCCCAGTGGGTGGGGGG + Intronic
1145004582 17:19330148-19330170 CAGTGGGCCAAGTGGCCAGTGGG + Intronic
1145004946 17:19332519-19332541 CATTGAGCCCTGAGGGCAGGGGG - Intronic
1145273631 17:21417633-21417655 CTGTGGGCCCAGTGGGGACGGGG - Exonic
1145273707 17:21417945-21417967 CAGTCATCCCAGTTGGCAGGAGG - Exonic
1145311826 17:21705075-21705097 CTGTGGGCCCAGTGGGGACGGGG - Intergenic
1146063667 17:29619728-29619750 CAGTGTGCCCAGTGACCAGTGGG + Exonic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1147887935 17:43697170-43697192 CACTGTGCTCAGTGGGCACTGGG + Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1150676076 17:67246222-67246244 CAGTGTGGCCGGCGGGCTGGGGG - Intergenic
1151409747 17:73914394-73914416 CTTTGTGCCCAGTGGGCAAAAGG - Intergenic
1151833734 17:76570174-76570196 CAGTGTGCTCAGTGGGACAGCGG + Intronic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1151945334 17:77316507-77316529 TAGTGTGCACAGCGTGCAGGAGG + Intronic
1152025133 17:77804041-77804063 TAGTGAGCCCAGTGGGAAGCAGG + Intergenic
1152185034 17:78850559-78850581 CAGTGTGCACATGGGCCAGGGGG + Intergenic
1152433282 17:80260952-80260974 CAGTGGGCCCCGCGGGCCGGCGG + Intronic
1152584733 17:81183830-81183852 CTGTGTGGCCAGTGAGCAGCTGG - Intergenic
1152584970 17:81184916-81184938 CAGTGAGCCCACCGGACAGGGGG + Intergenic
1153948558 18:10037956-10037978 CTGTGTGCCACGTGGTCAGGAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155786757 18:29912521-29912543 CACTGTGCCCAATGGCCAAGTGG + Intergenic
1157339019 18:46762665-46762687 CAGAGAGGTCAGTGGGCAGGGGG + Intergenic
1157624705 18:49041738-49041760 CAGTGAGCCCAGAGGCCTGGAGG + Exonic
1160052987 18:75454761-75454783 CAGGGTGCATAGTGGGCAGCCGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160310813 18:77788453-77788475 AGGTGCTCCCAGTGGGCAGGAGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1161090924 19:2359902-2359924 GAGTGGGCGCTGTGGGCAGGTGG - Intergenic
1161137233 19:2626902-2626924 CAGTGTCCACAGTGCCCAGGGGG + Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1162128277 19:8511016-8511038 CCGCGTGCCCTGCGGGCAGGCGG + Exonic
1163112497 19:15170092-15170114 CAGAGTGCCCAGAGGCCAAGCGG - Exonic
1163197358 19:15732510-15732532 CAGTGAGCCCTGTGTGCTGGAGG + Intergenic
1163678179 19:18665897-18665919 CATTGAGCCCATGGGGCAGGCGG - Intronic
1164152641 19:22568524-22568546 CAAGGTGCTCAGTGGGCAGGAGG - Intergenic
1164713758 19:30376910-30376932 CTGTGTGCACAGTGGGTACGGGG + Intronic
1166688445 19:44809439-44809461 CAGGGTGCTGAGTGGGAAGGGGG - Intronic
1166704936 19:44903377-44903399 CAGCATGCCCAGTGGGCCTGGGG + Exonic
1166991233 19:46693971-46693993 GGGTGGGCCAAGTGGGCAGGGGG - Exonic
1167031749 19:46966848-46966870 CAGTTTGCCCAGTGCCCATGAGG + Intronic
1167494170 19:49808377-49808399 CAGTGCTCCCACTGCGCAGGCGG - Intronic
1168728542 19:58606375-58606397 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1202645793 1_KI270706v1_random:140099-140121 CACTTTGACCAGTGGGCTGGTGG + Intergenic
925036993 2:695255-695277 CATGGAGCCCAGTGGGAAGGTGG - Intergenic
925045122 2:767037-767059 CAGAGGATCCAGTGGGCAGGAGG + Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926721375 2:15963981-15964003 CAACATGCCCAGTGGACAGGAGG - Intergenic
927255569 2:21037780-21037802 CAGTGAGCCTAAGGGGCAGGAGG + Intronic
927943196 2:27118658-27118680 CTGTGTACCCTGAGGGCAGGTGG - Intronic
929437626 2:41940535-41940557 CAGTGTCTTCGGTGGGCAGGGGG - Intronic
929732003 2:44504975-44504997 CAGTGTGCACAGAGGTCATGTGG + Intronic
932283565 2:70514748-70514770 GCGTGTGCTCGGTGGGCAGGAGG + Intronic
932418691 2:71588721-71588743 CAGTTTGGGTAGTGGGCAGGAGG + Intronic
933797972 2:85936577-85936599 CTGAGTGGCCAGTGGGCTGGGGG + Intergenic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
934618665 2:95791069-95791091 CAGTCTGCCCGGTGTGCAAGAGG - Intergenic
934642228 2:96033488-96033510 CAGTCTGCCCGGTGTGCAAGAGG + Intronic
935229356 2:101082406-101082428 CAGGGTGCCCAGCCTGCAGGAGG - Intronic
935293371 2:101628062-101628084 CAGGGTGCCCGGTGTGCAGCAGG - Intergenic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
936316581 2:111429447-111429469 CAGAGTCCACAGTGGGCAGTTGG + Intergenic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
936569962 2:113604324-113604346 CAGTGTGCCCAGCTGCCAGCAGG - Intergenic
937325551 2:120987940-120987962 CACCGTGCCCAGTGAGCAGATGG - Intronic
937932485 2:127218106-127218128 CTGTCTGAGCAGTGGGCAGGAGG + Intronic
938212870 2:129483277-129483299 GAGTGTGCCCAGTGGAAAAGAGG - Intergenic
938388283 2:130883236-130883258 GAGGGTGGCCAGTGGGCATGGGG + Intronic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941421512 2:165287705-165287727 AGGTGTCCCCAGTGGGCAAGGGG - Intronic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946694049 2:222333929-222333951 CAGTGAGCCAAGTGGGTGGGAGG - Intergenic
947534663 2:230933277-230933299 CAGTCTGCCCAGGTGGCTGGAGG - Intronic
947605103 2:231481037-231481059 CTGGGTTCCAAGTGGGCAGGGGG + Intronic
947615499 2:231554542-231554564 CAGTGAGCCCTGTGTGCAGTTGG - Intergenic
948204401 2:236155525-236155547 CAGGGAGACCAGTGGGCACGGGG - Intergenic
948748053 2:240110059-240110081 CAGGGTGCCCTGGGGGCTGGAGG + Intergenic
948900525 2:240954584-240954606 CAGTGTGCTCAGCAGCCAGGAGG + Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
949088800 2:242182017-242182039 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
1168849553 20:967202-967224 CAAAGTGCCCGGCGGGCAGGTGG + Exonic
1169247912 20:4038355-4038377 CAGTCAGCCCAGAGGGCGGGTGG + Intergenic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1169388933 20:5173832-5173854 CAGTGAGCACAGTGACCAGGAGG + Intronic
1169488443 20:6052569-6052591 CAGTGTGCGCGGTAGGCAGCCGG + Exonic
1169933457 20:10858207-10858229 CATTGTGCCCAGTGGCTAAGTGG - Intergenic
1170704506 20:18733169-18733191 CAGTTGGCTCAGTGGGCAGAAGG + Intronic
1170763901 20:19274257-19274279 CAGCCTGTCCAGTGGGCAAGGGG - Intronic
1170765880 20:19289770-19289792 CAGTGTGCCCAGGGGACTTGGGG + Intronic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1172080984 20:32340488-32340510 AAGTGTGCTTAGTGGGCAGTAGG + Intergenic
1172278430 20:33693972-33693994 CCAGGGGCCCAGTGGGCAGGAGG + Intergenic
1173618206 20:44416498-44416520 CACAGTGCCCAGTGCGCAGGAGG + Intronic
1175542445 20:59756194-59756216 CACTCTGCCAGGTGGGCAGGAGG - Intronic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175851754 20:62097543-62097565 CAGTGGGTGCAGTGAGCAGGGGG - Intergenic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1176606089 21:8832650-8832672 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1179815131 21:43900736-43900758 CTGTGTGCTCAGTGGCCAGAGGG + Intronic
1179830248 21:43992033-43992055 GAGTGTGCGCAGTGGCAAGGGGG + Intergenic
1180348387 22:11724256-11724278 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180356160 22:11842348-11842370 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180382097 22:12149979-12150001 CACTTTGACCAGTGGGCTGGTGG + Intergenic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1180766668 22:18349407-18349429 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1180779645 22:18512971-18512993 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1180812361 22:18770292-18770314 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181198520 22:21204539-21204561 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181333240 22:22111049-22111071 CAGTCTGGCCAGTGAGCAGCAGG + Intergenic
1181401218 22:22651261-22651283 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1181582210 22:23834645-23834667 CAGATTCCCAAGTGGGCAGGTGG + Exonic
1181628469 22:24137341-24137363 GAGTGAGCCCAGTGGGAAAGGGG - Intronic
1181648312 22:24245630-24245652 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181703183 22:24632341-24632363 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1182420025 22:30244546-30244568 CAGGGTGCCCAGTTAGCAAGGGG - Intronic
1182442291 22:30371563-30371585 CAGTGTGCCCCGTGGAGTGGAGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183775043 22:39958488-39958510 CTGTGTCCCCAGTGCCCAGGAGG + Intronic
1184097627 22:42325176-42325198 CCGAGTGCCCAGTCGGGAGGAGG - Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184650423 22:45917071-45917093 CACAGTGCCCAGTGGGCAGGTGG - Intergenic
1184810020 22:46824907-46824929 CAGGGTGTCAAGTGGGCAGCTGG + Intronic
1184856133 22:47147788-47147810 AGCTGTGCCCAGTGGCCAGGAGG + Intronic
1184955813 22:47885321-47885343 GAGTGTTCCAGGTGGGCAGGGGG - Intergenic
1185337658 22:50278005-50278027 CAGTGTGCCCTGTGGGGGGGAGG + Exonic
1203228285 22_KI270731v1_random:90298-90320 CAGTCTGCACAGAGGACAGGGGG - Intergenic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950149046 3:10671958-10671980 CAGTTTGCACTGTGGGCAGAGGG + Intronic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
951506401 3:23449954-23449976 CAGTGGGCCCAGTGGCCAGGAGG - Intronic
952130577 3:30356984-30357006 CACTGGGCCAAGTGGGCAAGTGG - Intergenic
952476570 3:33717378-33717400 CGGTCTGCCCAGTGGGGACGCGG + Intronic
953197321 3:40746627-40746649 GTATGTGCCCAGTGGGGAGGAGG + Intergenic
953687742 3:45091410-45091432 CAGCGTGCCCAGAGACCAGGTGG - Exonic
953698721 3:45179806-45179828 TAGGGTGCCCTGCGGGCAGGGGG - Intergenic
953990279 3:47478052-47478074 CAGTGGGCCCAGGGCTCAGGAGG - Intergenic
955216614 3:56989516-56989538 GTCTGTGCCCAGGGGGCAGGGGG + Intronic
955441138 3:58956393-58956415 CAGTACTCCCAGTGGGCATGAGG + Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
959588618 3:108051114-108051136 CATTGTGCCTAAAGGGCAGGTGG - Intronic
961390502 3:126549924-126549946 CAGTGTGCCGGGTGGACAGCAGG + Exonic
961606424 3:128098849-128098871 CAGTGTGCCCTGTGAGCAAGGGG - Intronic
962308857 3:134312069-134312091 CAGAGTGCCCAGGTGGCAAGTGG - Intergenic
965367705 3:167820580-167820602 GAGGGGGCCCAGTCGGCAGGGGG - Intronic
968001251 3:195208381-195208403 GCGTGTGGGCAGTGGGCAGGTGG - Intronic
968423660 4:506338-506360 CATCGTGCCCTGAGGGCAGGTGG + Intronic
968833693 4:2947389-2947411 CAGCATGCCAAGTGGGCAGGTGG - Intronic
971238626 4:24867298-24867320 CAGTTTGCCCAGTCAGCAAGTGG + Intronic
972950248 4:44312907-44312929 CAATGTGTCCAGTTGGGAGGAGG + Intronic
973372019 4:49258517-49258539 CACTTTGACCAGTGGGCTGGTGG + Intergenic
973388986 4:49536801-49536823 CACTTTGACCAGTGGGCTGGTGG - Intergenic
982068024 4:151671807-151671829 GAGTGTGCTGTGTGGGCAGGGGG + Intronic
985287814 4:188354740-188354762 CACTGTGCCCATTGGGGAGGGGG + Intergenic
985466631 4:190203224-190203246 CAGTGTGCCCAGCTGCCAGCAGG + Intergenic
985487863 5:162075-162097 CCGTGGGCGCAGTGGCCAGGGGG - Intronic
985585316 5:729371-729393 CTGTGTGCCCAGAGAGCACGGGG + Intronic
985598828 5:813698-813720 CTGTGTGCCCAGAGAGCACGGGG + Intronic
985708427 5:1414700-1414722 CAGTGTGCCCATCGGGGACGTGG - Exonic
985875636 5:2591838-2591860 CAGTGTGCACATTGGGGTGGAGG - Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987558348 5:19484576-19484598 AAGTGTGACCTGGGGGCAGGTGG - Intronic
988591201 5:32551169-32551191 CACTGTGCTCGGTGGGCAAGAGG + Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
992102807 5:73423540-73423562 CAGGGTCCCCAGTAGGTAGGTGG + Intergenic
992438139 5:76774752-76774774 CAGTTTGCCTAGTGGACAGTAGG - Intergenic
993524316 5:88945441-88945463 CAGAATGCCCAGTGTGCGGGTGG + Intergenic
994766698 5:103927457-103927479 AAGTGTGCCCTGTGGACATGTGG - Intergenic
995774323 5:115709502-115709524 AAGTGTGGCCCATGGGCAGGAGG + Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
998367278 5:141639631-141639653 CTGTGTTCTCTGTGGGCAGGTGG + Exonic
998474567 5:142409417-142409439 CAGTTTGCCCAGCAGGCAGGAGG - Intergenic
1001601170 5:172929491-172929513 CAGTGTCTCCAGTGGGCATTTGG + Intronic
1001927844 5:175651889-175651911 CTGTGTGCCAAGTGGGCACATGG - Intergenic
1002586383 5:180251532-180251554 CTGTGTGGCCAATGGGGAGGTGG + Intronic
1002601640 5:180357064-180357086 CAGAGGGCCCAGGGGGCTGGGGG + Intergenic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1003278586 6:4673434-4673456 CACTGGCCCCAGTGGGCAAGAGG - Intergenic
1003837239 6:10084857-10084879 CAGGTGGCCCAGTGAGCAGGAGG - Intronic
1006014638 6:31070618-31070640 CAGTCTGTCCACTGGGGAGGGGG - Intergenic
1006583727 6:35091896-35091918 AAGTGTTCCCAGAGGGCTGGTGG + Intergenic
1006799684 6:36752019-36752041 GTGTGTGCTCAGTGGGTAGGAGG + Intronic
1007312927 6:40961061-40961083 CAGCCTGGTCAGTGGGCAGGAGG + Intergenic
1007370803 6:41426031-41426053 CAGTGAGCTCAGTGAGGAGGTGG + Intergenic
1009798406 6:68502318-68502340 CAGTTTCCCCATTGGGCGGGGGG - Intergenic
1010237825 6:73589849-73589871 CACCGTGCCCGGTCGGCAGGTGG + Intergenic
1011029754 6:82909046-82909068 GAGTGTGGCAAGTGTGCAGGTGG + Intronic
1011656439 6:89556106-89556128 CACTGTGCCCACTTGCCAGGGGG - Intronic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1014436379 6:121425265-121425287 GAGTGGGGCCTGTGGGCAGGAGG - Intergenic
1015021295 6:128479011-128479033 AAATGTTCTCAGTGGGCAGGGGG + Intronic
1015924716 6:138297049-138297071 CACTGTGGCCATTGGGCAGTGGG + Intronic
1016780296 6:147950612-147950634 CACTGTGCCCATTAGGAAGGAGG - Intergenic
1016911263 6:149201363-149201385 CTGTGTGCCCAGTCCCCAGGGGG - Intergenic
1018908042 6:168086561-168086583 CAGTGTCCACACTGGGCACGTGG - Intergenic
1019272753 7:159742-159764 CTGTGTGTGCAGTGGACAGGTGG - Intergenic
1019447439 7:1078745-1078767 CCGGGGTCCCAGTGGGCAGGTGG - Intronic
1019477355 7:1250372-1250394 CACTGTGCCCAGTGCCCAGCAGG + Intergenic
1019557750 7:1641103-1641125 GAGGGGGACCAGTGGGCAGGTGG - Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019842795 7:3465239-3465261 CAGTTGGCCAACTGGGCAGGAGG - Intronic
1020342850 7:7131361-7131383 CTGTGTGCCCAGTGGGCTGGAGG - Intergenic
1020561067 7:9728960-9728982 CTGTGTTCCCAGGTGGCAGGGGG + Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1023817348 7:43961338-43961360 CAGAGGTCCCAGTGGGTAGGGGG + Intergenic
1025145272 7:56496215-56496237 CAGTGTGTCCTGTGGTCATGAGG - Intergenic
1025211159 7:57020279-57020301 GAGCGTGCACAGTGGGCCGGGGG + Intergenic
1025260876 7:57416714-57416736 CAGTGTGTCCTGTGGTCATGAGG - Intergenic
1025660796 7:63556568-63556590 GAGCGTGCACAGTGGGCCGGGGG - Intergenic
1026487764 7:70836090-70836112 AAGTGTGCCCAGTGGGCTCTAGG - Intergenic
1027256032 7:76431254-76431276 CAGGCTGCCCAGTCGGCATGAGG + Intronic
1029741974 7:102496212-102496234 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029749104 7:102533130-102533152 CAGTGTGGCATGTGGCCAGGTGG + Intergenic
1029759963 7:102595377-102595399 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029767047 7:102632234-102632256 CAGTGTGGCATGTGGCCAGGTGG + Intronic
1030820706 7:114087548-114087570 CAGTGGCCCCGGCGGGCAGGCGG + Intronic
1031960578 7:127985807-127985829 CAGTGTACCCCGTGGACAGAAGG + Intronic
1031994068 7:128217064-128217086 CAGTCTGCCCTTTGGGCAGCAGG + Intergenic
1032358143 7:131229318-131229340 CACTGGGGCCTGTGGGCAGGTGG - Intronic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1033242245 7:139689990-139690012 CGGTGTGCACAGGGGGCTGGGGG + Intronic
1033353973 7:140584661-140584683 CTGAATGCCCAGAGGGCAGGGGG - Intronic
1034210469 7:149358386-149358408 GAGGGGGCCAAGTGGGCAGGGGG + Intergenic
1035112902 7:156498056-156498078 CAGATTGCCCGGTGGGAAGGGGG + Intergenic
1035589377 8:801583-801605 CTGTGTGGCCAGTGGGCTTGTGG + Intergenic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1035716036 8:1755609-1755631 CGGTCTGCCCAGAGGGCTGGGGG + Intergenic
1037816473 8:22115259-22115281 CAGTGAGCCCAGTGAGGATGCGG + Exonic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039292443 8:36111080-36111102 CAGTGGGCCCAGTGGGCGCCTGG - Intergenic
1039739789 8:40372218-40372240 CACTGTTCCCTGTGGGCATGTGG + Intergenic
1040969099 8:53114507-53114529 CTGTGTGGGCAGTGGGCTGGGGG - Intergenic
1041256666 8:55984679-55984701 CTGTGTGACCACTGGGCTGGGGG - Intronic
1041639523 8:60181499-60181521 CACTGGGGCCTGTGGGCAGGTGG + Intergenic
1043756024 8:84005355-84005377 GAATGAGCCCAGTGGGCACGGGG - Intergenic
1044277767 8:90322126-90322148 CAGTGGAGTCAGTGGGCAGGAGG + Intergenic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1048187022 8:132250736-132250758 CAGAGTGCCCAGTGAGCTGGGGG - Intronic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048418292 8:134251064-134251086 CAGTGTGTCCATTGGGCACAAGG + Intergenic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049532552 8:143161760-143161782 AAGTCTGCCCACTGAGCAGGAGG + Intergenic
1049701173 8:144013510-144013532 CAGGGAACCCAGTGGGTAGGGGG - Intronic
1049867437 8:144947911-144947933 CAGTGCTCCCAGTGGGCACCCGG - Intronic
1049869829 8:144965930-144965952 CAGTGTGCAGACTTGGCAGGTGG - Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1055621136 9:78126146-78126168 GAGTGAGCCCTGTGGTCAGGTGG - Intergenic
1056588339 9:87944107-87944129 GAGTGTGCCAACAGGGCAGGTGG + Intergenic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059326418 9:113506541-113506563 CAGTGTGCCCAGGGGTGGGGAGG - Intronic
1059727391 9:117022817-117022839 CAGAGTGGGCAGTGGGCAGTGGG + Intronic
1060472451 9:123959524-123959546 CACTGTGTCCAGTGGGAAAGAGG - Intergenic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061386017 9:130289775-130289797 CAGGGTGCCCAGCTGGCAAGGGG + Intronic
1061493542 9:130959245-130959267 CACTGGGCCCTGTGGGCAGGTGG - Intergenic
1061499265 9:130992862-130992884 CAGCCAGCCCAGTGGGCAAGGGG + Intergenic
1062264577 9:135681168-135681190 CAGTGTGCTCTGTGGGCAGGGGG + Intergenic
1185755660 X:2651137-2651159 GAGCGTGCCCAGTGGGGAGGCGG - Intergenic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1187418534 X:19114471-19114493 CAGTGATTCCAGTGGGCAGCGGG + Intronic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1187842855 X:23506724-23506746 CAATCTTCCCAGTGAGCAGGTGG - Intergenic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1190960369 X:55240919-55240941 CTGAGTTCCCAGTGGGGAGGGGG + Intronic
1191258719 X:58291234-58291256 CACTGTGCCCAGTGGGGTTGTGG + Intergenic
1192359676 X:70431544-70431566 CATAGTGCCCAGAGGACAGGAGG + Intronic
1195048776 X:101078610-101078632 AAGTGAGCCCGGTGGGAAGGTGG + Intergenic
1196711733 X:118770240-118770262 CAGGGTGCACGATGGGCAGGCGG - Intronic
1197570786 X:128147772-128147794 TATTGTGACCAGTGGTCAGGGGG + Intergenic
1197755053 X:129987584-129987606 CAGTGTTTCCAGTCTGCAGGTGG + Intronic
1199755114 X:150856383-150856405 CTGAGTGCCCAGTCGGCATGTGG - Intronic
1199778578 X:151037568-151037590 CAGGAAGCCCAGTGGGCAGAAGG + Intergenic
1200344544 X:155435560-155435582 CAGAGCCCCCTGTGGGCAGGGGG + Intergenic
1201587347 Y:15575644-15575666 CTGTGTGGCAAGTGGGCAGCTGG - Intergenic