ID: 1148859129

View in Genome Browser
Species Human (GRCh38)
Location 17:50594974-50594996
Sequence TTTCCTACAGGGAAAGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148859129_1148859138 2 Left 1148859129 17:50594974-50594996 CCTCCCCCTTTCCCTGTAGGAAA 0: 1
1: 0
2: 2
3: 26
4: 288
Right 1148859138 17:50594999-50595021 AGCAAACGGGAAGATGCGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148859129 Original CRISPR TTTCCTACAGGGAAAGGGGG AGG (reversed) Exonic
900654139 1:3746882-3746904 TGTCCCACAGGAGAAGGGGGAGG + Intergenic
900831787 1:4970645-4970667 TTTTCTGAAGGGAAAGAGGGAGG - Intergenic
901327575 1:8377565-8377587 TTTTCTACCAGCAAAGGGGGAGG + Intronic
902036942 1:13464753-13464775 CTTCCTCCAGGGACAGGTGGTGG + Intergenic
902919572 1:19657896-19657918 TTTCTAACAGGGAGAGGAGGGGG - Exonic
905770876 1:40637107-40637129 TTGCCTACAGGGAGGGGGAGAGG + Intronic
907384675 1:54118334-54118356 GTTCCTGCAGGGGGAGGGGGAGG - Intergenic
908582095 1:65526290-65526312 TTGCTTGCAGGGAAGGGGGGAGG - Intronic
910073566 1:83248512-83248534 TTTTCTGCAGTGAAAGGGGAGGG + Intergenic
910449483 1:87331423-87331445 TTTCCGAAAGGGAACGAGGGAGG - Intronic
911483069 1:98469209-98469231 TTTGTTACAGAGAAAGTGGGAGG + Intergenic
911641911 1:100298570-100298592 TTTCCTAAAGGAGAAGGGGAGGG + Intergenic
911666550 1:100559403-100559425 TTTCCCACAGAGACAGGAGGAGG + Intergenic
913706431 1:121428861-121428883 TTTCCTATAGGGGTATGGGGAGG - Intergenic
914232461 1:145776076-145776098 TTGACCACAGGGTAAGGGGGGGG + Intronic
915195475 1:154185835-154185857 TTACCTACTGGGAAGGTGGGAGG - Intronic
915517635 1:156422343-156422365 ATTCCTACAGGGAGATGCGGGGG + Intronic
915603152 1:156935168-156935190 TTTTCTACAGGGACAGGGTGGGG + Exonic
917107913 1:171513202-171513224 TTCCCTACAAAGAAAGGGGAAGG - Intronic
917160199 1:172048863-172048885 TTGCCTACAGGGAATGGTTGTGG + Intronic
917178515 1:172265982-172266004 CTTTCTATAGGAAAAGGGGGAGG - Intronic
918113971 1:181482002-181482024 TTTCCTACAGCGGAACCGGGAGG + Intronic
918284467 1:183038362-183038384 TTTCTTACAGGGAGAGTGGGTGG + Intronic
920279112 1:204829651-204829673 TTTCCTAGATGGATTGGGGGAGG + Intronic
920338799 1:205262503-205262525 TTTCCTCCAGGGATGGGGGCAGG + Intronic
922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG + Intergenic
922145855 1:222943545-222943567 TTGCAGACAGGGAAAGGGGAAGG - Intronic
924227247 1:241932262-241932284 TTACCTGCAGGGACAGGGGTGGG + Intergenic
924800536 1:247326919-247326941 TTTCTTTCAGGGAAAGGAAGAGG - Intronic
1064991399 10:21259823-21259845 CTTCCTAGAGGGCAGGGGGGTGG + Intergenic
1065023384 10:21518683-21518705 TTTCCAAAAGGAAAAGGGGGTGG - Exonic
1067152515 10:43748585-43748607 TTTATTACAGTGAAAGGAGGAGG + Intergenic
1068153539 10:53166468-53166490 TTTCCTACAATGAAAGGGTCAGG - Intergenic
1068166997 10:53343124-53343146 TTTCCTTCAGAAAAAGTGGGAGG - Intergenic
1069042333 10:63708895-63708917 TCTGCTACCAGGAAAGGGGGAGG - Intergenic
1069088200 10:64166700-64166722 TCTACTGGAGGGAAAGGGGGAGG + Intergenic
1069756851 10:70778748-70778770 GATCTTAAAGGGAAAGGGGGAGG + Intronic
1069831498 10:71284879-71284901 GTTCCTGCAGGGACAGGGTGGGG - Intronic
1069892797 10:71662436-71662458 TATCCCACAGGGCAAGGGAGAGG + Intronic
1070257822 10:74826233-74826255 TTTCCTAGAGGTGGAGGGGGCGG + Intronic
1070760193 10:79019450-79019472 TGTCCAAGAGGGAAAGGGGAAGG - Intergenic
1071300770 10:84254307-84254329 GTTTCTACAGGGAGAGCGGGTGG - Exonic
1072794804 10:98346573-98346595 TTAATTAAAGGGAAAGGGGGAGG + Intergenic
1074868776 10:117561172-117561194 TGTCCCACAGAGGAAGGGGGAGG - Intergenic
1076045322 10:127289065-127289087 TTTCCTGTAGGGAAAGGTAGGGG - Intronic
1076701981 10:132278017-132278039 TTCCCTCCAGGGAGAGGTGGGGG + Intronic
1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG + Intergenic
1078257636 11:9673656-9673678 CTTCCTCCAGGGTATGGGGGAGG + Intronic
1078595232 11:12680712-12680734 ATCCCTACTGGGATAGGGGGAGG + Intronic
1079014647 11:16858198-16858220 TTTTCTGCAGGGGAAGGAGGTGG + Intronic
1080572706 11:33570542-33570564 TTCCCTAGTGGGAAAGGAGGTGG - Intronic
1081452942 11:43190682-43190704 TTTACTAGAGGGAAAGGAGTGGG - Intergenic
1081755384 11:45540700-45540722 TCTCCCACAGGGAAATGGGAAGG - Intergenic
1082942009 11:58716106-58716128 TGTCCAACAGGGCAAGGGTGGGG - Intronic
1083292211 11:61696490-61696512 TCTCCCACAGGGGAAGGGGAGGG - Intronic
1087323144 11:96687054-96687076 GTTCCAACAGGAAAAGGAGGGGG - Intergenic
1088053612 11:105549759-105549781 GCTCCTACATGGAAAGGTGGGGG + Intergenic
1088455294 11:110027025-110027047 TATACAACAGAGAAAGGGGGAGG + Intergenic
1089018734 11:115189113-115189135 GTTCCTGCAGGGAGTGGGGGAGG + Intronic
1089068097 11:115677492-115677514 TTTCCAGCTGGGAAAGAGGGTGG - Intergenic
1089436322 11:118471832-118471854 TTTACTCCAGGGAAGGTGGGAGG - Exonic
1091646123 12:2273760-2273782 GTTCCTACAGGGAAGGGAGACGG + Intronic
1091778890 12:3201523-3201545 TTTCTTATAGGGGAAGGAGGTGG - Intronic
1094373307 12:29762386-29762408 TTTTTTTCAGAGAAAGGGGGTGG + Intronic
1095158095 12:38882912-38882934 TTTCCTAGCAGGAAAGGGGTTGG - Intronic
1099277526 12:80596459-80596481 TTTCATAAAGGAAAAAGGGGAGG + Intronic
1099293040 12:80795902-80795924 TTTACTAGAGAGAACGGGGGTGG - Exonic
1100846920 12:98668749-98668771 TTTCCTGCAGAGAATGGGGATGG + Intronic
1101766955 12:107710536-107710558 TTTTTTACAGGGGCAGGGGGAGG - Intronic
1102379001 12:112447294-112447316 TTTCCTCTGGGGAAAGAGGGAGG - Intronic
1102414163 12:112746152-112746174 TTTGCTAAAGGAAAAGAGGGAGG - Intronic
1103597552 12:122032849-122032871 CGCCCTAGAGGGAAAGGGGGTGG - Intronic
1104682315 12:130760453-130760475 TTCCCTGCACCGAAAGGGGGTGG - Intergenic
1107036128 13:35904628-35904650 TTTCCTAAAGGCAAAAGGGAAGG - Intronic
1107200043 13:37704194-37704216 TTGCCTACGGGGGAATGGGGAGG + Intronic
1108835160 13:54536340-54536362 ATTCCTACAGGGAAAGGAGAAGG - Intergenic
1110331413 13:74277673-74277695 TTTCATCCAGGGAAAGGGGAAGG - Intergenic
1111630056 13:90839162-90839184 TTCCCTCCAGGGAAAGGGCTGGG + Intergenic
1112734781 13:102403486-102403508 TTACCTACAGAGAATGGGAGTGG - Intergenic
1113166095 13:107444407-107444429 TTTTCTATAGGGAAGGGGAGTGG + Intronic
1113248330 13:108423609-108423631 TTTCCTTCAGGCTTAGGGGGAGG + Intergenic
1113706969 13:112441364-112441386 TTTCCTACAGAGAAGAGGGACGG + Intergenic
1120983504 14:90312355-90312377 TTTCCTACAGTGAAAACTGGGGG + Intronic
1121614873 14:95306999-95307021 TATCCTCCAGGGAAAGGGGCTGG + Intronic
1121934947 14:98009797-98009819 TTTCTTAGAGAGAAAGGGAGAGG - Intergenic
1122009240 14:98732133-98732155 TTTCCTCAAGGGAAAAGGAGGGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1123963922 15:25437835-25437857 TTTTCTACACTGAAAAGGGGGGG + Intronic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124277236 15:28336271-28336293 TTTCCAACAGGGCAGGTGGGGGG + Intergenic
1124305465 15:28575335-28575357 TTTCCAACAGGGCAGGTGGGGGG - Intergenic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124968337 15:34457717-34457739 TTTTGTAGAGGGAAGGGGGGAGG - Intergenic
1124997035 15:34733649-34733671 TTCCCTCCAGGGAAAGTGAGTGG + Intergenic
1125398023 15:39270994-39271016 TTTCCAGCAGGGAAAGGCAGCGG - Intergenic
1125956006 15:43791763-43791785 TTTTCTACAGTGAAGGGGCGTGG + Intronic
1127560771 15:60133948-60133970 TTACCTACAGGAAAAGAGGATGG + Intergenic
1127890117 15:63242841-63242863 TTTCCTCCAGGGACTGGAGGTGG + Intronic
1128041441 15:64577981-64578003 TTTCTTGCAGGGAAGGGGGGTGG - Intronic
1128333362 15:66770736-66770758 TGTCCTAGAGGGAAGGAGGGTGG - Intronic
1129771298 15:78204998-78205020 TTTCCTAGGGAGAAAGCGGGTGG + Intronic
1130554505 15:84913357-84913379 CTTCCTCCAGGGAGAGGAGGGGG + Intronic
1131951873 15:97690123-97690145 TTTCTTAAAGGGAAGGGAGGTGG - Intergenic
1135126248 16:19811895-19811917 GTACCTACAGGGAAAGGGTCTGG + Intronic
1136009311 16:27352610-27352632 TTTCCTACAGGGCACGGGTGAGG + Exonic
1137750260 16:50856392-50856414 GTTCCTTCTGGGAAAGGGGTTGG + Intergenic
1138158997 16:54735757-54735779 CGACCTACAGGGAAGGGGGGTGG - Intergenic
1138517508 16:57544429-57544451 TTTGCTCCTGGGAAAGGGGGTGG + Intronic
1139334124 16:66219004-66219026 CTTCCTACAGGGCAGGGGAGTGG + Intergenic
1141939598 16:87266002-87266024 TTTCCTGCAGGGTCAGGAGGAGG - Intronic
1144705453 17:17364810-17364832 TTTTCTGCAGGGAATGGGTGTGG + Intergenic
1146002827 17:29141418-29141440 TTTCCTAAAGAGGAAGAGGGAGG - Intronic
1147138981 17:38451118-38451140 TTTCCCAGAGGAAATGGGGGAGG + Intronic
1147628306 17:41914169-41914191 TTGCCTAGAGGGAATGGGGCAGG - Intronic
1147867594 17:43563451-43563473 TTTCCTGGAGGGCAAGGGGGAGG + Intronic
1148195780 17:45711519-45711541 TTTCCAACAGGGCATGGAGGTGG - Intergenic
1148471176 17:47894501-47894523 TTTCCTGGAGGGAAAAGGGTAGG + Intergenic
1148859129 17:50594974-50594996 TTTCCTACAGGGAAAGGGGGAGG - Exonic
1148960535 17:51388844-51388866 TTTTTTAGAAGGAAAGGGGGTGG + Intergenic
1149964648 17:61150026-61150048 TTTCCTAACAGGAAAGGGGGTGG + Intronic
1150830385 17:68512891-68512913 TGTCCTTCAGGAAATGGGGGAGG - Intronic
1151750270 17:76033215-76033237 TTTCTCCCAGGGAAAGGGGATGG - Intergenic
1153218627 18:2843412-2843434 TTTCCAACAGGCAATGGAGGGGG + Intergenic
1155179973 18:23336199-23336221 TTTCCTGCAGGGAACGTGGGAGG - Intronic
1155532407 18:26780579-26780601 TTTCCTGCTGGGAAAGTAGGAGG - Intergenic
1156220023 18:35041652-35041674 GTTCCTACAGGTAATGGGGCTGG + Exonic
1156313502 18:35946722-35946744 TTTACTACAGAGGAAGGGGATGG - Intergenic
1156447597 18:37248944-37248966 TTTCCTGCAGGGAGGGAGGGAGG + Intronic
1158847554 18:61460642-61460664 TTACCTTCAGGGAAAGATGGTGG - Intronic
1160423712 18:78766663-78766685 TTTTCTCCAGGGAAAGGTGGGGG + Intergenic
1160607145 18:80059677-80059699 TGTCCTGCAGGAAGAGGGGGCGG + Intronic
1161627584 19:5336248-5336270 TTTCCTTAAAGGAAAAGGGGGGG + Intronic
1161627585 19:5336249-5336271 TTCCTTAAAGGAAAAGGGGGGGG + Intronic
1163466095 19:17469512-17469534 TTTCCTAAAAGGAGAGGGGGTGG + Intronic
1164763193 19:30743606-30743628 TGTCCTAAAAGGAAAGGGGAAGG - Intergenic
1164950970 19:32336625-32336647 TTTCCTGCACGGAGAGGGGCTGG - Intergenic
1165715581 19:38043852-38043874 TTCCTTACATGGATAGGGGGAGG + Intronic
1166154388 19:40899955-40899977 TTTCCTGCAGGCACAGGGGAGGG - Intergenic
1166816084 19:45547065-45547087 TTTCCTATGGGGAAGGAGGGAGG + Intronic
1166874732 19:45890642-45890664 TTCCCTACACGGAAAAGGCGCGG - Exonic
925883345 2:8370811-8370833 TTTCCTGCAAGGACAGGGTGGGG + Intergenic
926086915 2:10026260-10026282 GTTCCCACTGGGAAAGGGAGTGG - Intergenic
926116743 2:10218182-10218204 TGTCCTGCTGGAAAAGGGGGTGG + Intergenic
928704681 2:33935511-33935533 TTTTCTATAGGGAAAGAGGTGGG + Intergenic
929312735 2:40444376-40444398 TTTCTTACTGGGAAAGGTGGGGG - Intronic
929802400 2:45115399-45115421 TTGCCTCCAGGGACAGGAGGTGG + Intergenic
930516575 2:52414885-52414907 TTTGCTTCAGGCAAAGGAGGAGG + Intergenic
930673988 2:54180334-54180356 TAACCTCCAGGGAAAGGAGGGGG - Intronic
931122165 2:59231881-59231903 TTTCCTCCAGGGAAAGCGGAAGG - Intergenic
931190643 2:59996850-59996872 TTTCCTACTGGGAAAGATGTTGG + Intergenic
931429932 2:62200706-62200728 GTTCCTTCAGGGTGAGGGGGTGG - Intronic
933896235 2:86812330-86812352 TTTCCATCAGAGAAAGGGAGTGG + Intergenic
933985127 2:87584428-87584450 TATCCTGCAGGGATAGGCGGAGG - Intergenic
934300587 2:91774011-91774033 TGTCCAACAGGGCAAGGAGGAGG + Intergenic
935081355 2:99799395-99799417 TTCCCTAAAGGAGAAGGGGGAGG + Intronic
936008581 2:108910529-108910551 TTGTCTGCAGGGAAATGGGGAGG + Exonic
936375620 2:111938795-111938817 TTCCCTACAGGGAGAGGGCTGGG - Intronic
937112620 2:119378234-119378256 TTCCCTAAAGGGGATGGGGGCGG + Intergenic
937698591 2:124837560-124837582 TTTTATCCAGGGAAAGGGGTGGG + Intronic
938607887 2:132915321-132915343 ATTCCTACAGAGAAAGGAGCAGG + Intronic
938745253 2:134271887-134271909 TTTTCTACAGGGTACAGGGGTGG - Intronic
940251207 2:151678824-151678846 GTACCCACAGAGAAAGGGGGTGG + Intronic
942758184 2:179366232-179366254 TTTCCTACACTGAAAGTGGTTGG + Intergenic
944075232 2:195722232-195722254 TTTGCTAGAGGGAAAGGAGTGGG + Intronic
945709044 2:213273316-213273338 TTTCCAAGATGGAAAGGGTGAGG + Intergenic
948316029 2:237029141-237029163 TTTACTTCAGGGAAAGGAGTGGG - Intergenic
1170953986 20:20961809-20961831 TTGCCTACTGGGAAAAAGGGGGG + Intergenic
1172029285 20:31970074-31970096 TATCCTGGAGGAAAAGGGGGCGG + Intronic
1172665195 20:36594240-36594262 TTTCTTACCGAGAGAGGGGGAGG - Intronic
1173848536 20:46203079-46203101 TTTCCTCGAGGGGAAGGGAGGGG + Intronic
1174570176 20:51495841-51495863 TTTCCCACAGGGACAGAGGAGGG - Intronic
1176012159 20:62903801-62903823 TTTGCTCCAGGGACAGGAGGTGG - Intronic
1176416176 21:6476053-6476075 CGTCCTGCAGGGAAAGGTGGTGG + Intergenic
1179691676 21:43084387-43084409 CGTCCTGCAGGGAAAGGTGGTGG + Intergenic
1179957962 21:44751662-44751684 TTCCCTAAAGGAAATGGGGGAGG + Intergenic
1180030036 21:45200578-45200600 TTTATTGTAGGGAAAGGGGGAGG + Intronic
1182383341 22:29912641-29912663 TTACCTCCAGGCAAATGGGGTGG - Intronic
1182848728 22:33453025-33453047 TTTCCTTCTGGGAAAGCTGGAGG - Intronic
1183254916 22:36756151-36756173 TTTCCTACCTGGAAAAGGGCAGG - Intergenic
1183346552 22:37311437-37311459 TGTCCTACAGGGAAAGGGGAAGG - Exonic
1185158218 22:49207036-49207058 TTTCTTACAGGGAAACCAGGGGG + Intergenic
1185170782 22:49292638-49292660 CTTCCTACACAGAAAGGTGGTGG + Intergenic
1185188498 22:49417824-49417846 TATCCTACAGGGGAGTGGGGAGG + Intronic
949354406 3:3163031-3163053 AATCCAACAGGGAAAGGGGATGG - Intronic
952746867 3:36789971-36789993 TTTTCTACAGGGTGAGGAGGAGG - Intergenic
953007414 3:38991225-38991247 TTTCCTTCAGAGAAATGGTGGGG - Intergenic
953856568 3:46503807-46503829 TCAACTTCAGGGAAAGGGGGAGG - Intergenic
954713210 3:52514970-52514992 TCTCCTAGAGGGAAAAAGGGTGG - Exonic
955034938 3:55258439-55258461 TGTCCTACAGGGCAGGGGGCAGG - Intergenic
956399521 3:68862097-68862119 TTCCCCACAGGGAAAGCGTGTGG - Intronic
958181021 3:90061120-90061142 AGTCCTACAGGGAAAGGAGATGG + Intergenic
959179261 3:102957588-102957610 TTTCCCACAGGTCAAGGGTGAGG - Intergenic
962853866 3:139327484-139327506 CTTCCTACAGGGAAAAGGCAGGG - Intronic
963282809 3:143402711-143402733 TATCCTGAAGGGAAAGGGGATGG - Intronic
963323886 3:143839948-143839970 TCTCCTATGGTGAAAGGGGGAGG - Intronic
963891039 3:150636321-150636343 ATTCCTATAGGGAAGGGGGCTGG + Intergenic
964112054 3:153097950-153097972 TTTCCCAGAGGGATAGGGGAAGG + Intergenic
964528739 3:157644280-157644302 TTTCAGACAGGGTAATGGGGTGG - Intronic
964960516 3:162417890-162417912 TTTCCTCAGGGGAAAGGGGCGGG + Intergenic
965453209 3:168864312-168864334 TTTCATCAAGTGAAAGGGGGAGG - Intergenic
965494571 3:169382206-169382228 TTTCCAGCGGGGAAAGGGAGAGG + Intronic
965742926 3:171895446-171895468 TTGCCAAGAGAGAAAGGGGGAGG - Intronic
966600787 3:181773260-181773282 TCTCCAAGAGGGAAAGGGAGAGG + Intergenic
967902020 3:194464545-194464567 TTCTCTACAGGGAAAGAGGTTGG - Intronic
967937580 3:194741228-194741250 TTTGATGCAGGGAAAGGGCGGGG + Intergenic
967977053 3:195041305-195041327 TCTCCTCCAGAGAATGGGGGCGG - Intergenic
968442888 4:633486-633508 CTTGCTGCAGGGGAAGGGGGTGG + Intronic
968732050 4:2273821-2273843 TTTCCTCCAGGGAGTGGCGGCGG - Intronic
968961385 4:3746011-3746033 CTTCCTGCAGGGAGTGGGGGAGG + Intergenic
969137399 4:5041156-5041178 TTTTCTTCAGGGAAATGGGTGGG + Intergenic
969553615 4:7890825-7890847 CTTCCCACCGGGAAAGTGGGAGG - Intronic
971388634 4:26164767-26164789 TTTTCTACTGGAAAATGGGGGGG + Intronic
974251129 4:59384940-59384962 TATCCTACATGGAAAGGCTGTGG + Intergenic
975717457 4:77218582-77218604 TTTTCTTCAGGGAAAGCAGGGGG + Intronic
975949177 4:79747352-79747374 TTTCCAAAATGGAAAGGAGGTGG - Intergenic
978077239 4:104547222-104547244 TTTCCTCCAGAGCAAAGGGGAGG - Intergenic
978311736 4:107391653-107391675 AATCCTACAGGCAAAGGAGGTGG + Intergenic
978490624 4:109307649-109307671 TTTCCTAAAGGGAATGGAGTAGG + Intergenic
980132658 4:128831103-128831125 TTTCCTAATGTGAAAGGGAGGGG + Intronic
981023085 4:140049250-140049272 TTTCCAACAGGAAAGGGAGGCGG - Intronic
984184131 4:176521574-176521596 CTTCCTAGAGGGAAAAGGGTGGG + Intergenic
985693128 5:1324583-1324605 TTTCTTACTGGGAAGGGCGGGGG - Intronic
987212423 5:15696348-15696370 TTGGCTTCAGGGAAAGGGAGAGG + Intronic
989067788 5:37481331-37481353 TTTGCTGCAGGGAGCGGGGGGGG - Intronic
989539665 5:42604398-42604420 TTTCCTCCAGGGAATGGGGCAGG + Intronic
989623823 5:43410648-43410670 TCTCCTACAGGAAAGGAGGGAGG - Intronic
989971238 5:50527074-50527096 TTTCCTAAAGGGGTATGGGGAGG + Intergenic
990555919 5:56935497-56935519 TTTCCTACAGGAAAATTGAGAGG + Exonic
992074018 5:73174460-73174482 CTTCCTACAGAGAAGGGGGAGGG - Exonic
992262767 5:74987457-74987479 TTTGCTGCAGGGAATGGGGTGGG - Intergenic
994714377 5:103304409-103304431 ATGACTACAGGGGAAGGGGGAGG - Intergenic
995553671 5:113305185-113305207 TTTCCTACAGGGACAGGCTGAGG + Intronic
999816234 5:155179048-155179070 GTTGCTACAGGGAAAGGCAGAGG + Intergenic
1001092729 5:168753095-168753117 CATCCTACAGGGAGAGGGGTGGG + Exonic
1001882830 5:175259536-175259558 TCTCCTCCAGGGAAATGGGTTGG - Intergenic
1002212063 5:177605026-177605048 TTACCTAGAGGGAAAGGAGGTGG - Intronic
1002963939 6:1943495-1943517 TTTTCTGCAGGGAGAGGGAGGGG + Intronic
1003460664 6:6324930-6324952 ATCCATACAGGGAAAGGGTGAGG + Intergenic
1004221881 6:13754210-13754232 TTTCCTTTACGGAAAGGAGGGGG + Intergenic
1004449256 6:15729634-15729656 TTTCTTACAGGGAAAAGATGAGG + Intergenic
1006745972 6:36342228-36342250 TTTGCTAGAGGGGAGGGGGGCGG + Intergenic
1006941534 6:37754947-37754969 CTTCCAACAGGGAAGGGGGCAGG - Intergenic
1007330136 6:41100762-41100784 TTTTCTACTGGAAACGGGGGAGG - Intergenic
1009537670 6:64909570-64909592 TTTTCTACAGGAAAATGAGGAGG - Intronic
1011507513 6:88062779-88062801 TTTCCTAAAGAGAGAGGGGTCGG + Intronic
1011778062 6:90754214-90754236 TTTCATCCAGGGAAGGTGGGAGG - Intergenic
1013598868 6:111685510-111685532 TTTCTTACAGCCAAAGGAGGGGG - Intronic
1014357475 6:120431372-120431394 ACTCCTACAGGGAAAGGGTGAGG + Intergenic
1014742843 6:125166715-125166737 TTTACTACAGGAAAGGGAGGTGG + Intronic
1014884164 6:126759330-126759352 TTTTCTTCAGGGAAAGAGAGTGG - Intergenic
1014965277 6:127740111-127740133 ATTCCTCCAGGGAAAGAAGGAGG + Intronic
1015352007 6:132231117-132231139 TTTCCCACAGAAAAAGTGGGGGG - Intergenic
1016035178 6:139376518-139376540 TGACCTACAGGTAAAGGTGGTGG - Intergenic
1018090889 6:160346799-160346821 TTTCCTTCTGGGTAAGGGGCAGG + Intergenic
1019439964 7:1041031-1041053 GTTCCCACAGGGAACGTGGGAGG - Intronic
1019548933 7:1592671-1592693 GTCCCTGCAGGGAAAGGGGGCGG - Intergenic
1019956988 7:4423500-4423522 TTTCCTACAGGGGCAGGAGGGGG + Intergenic
1020690309 7:11346737-11346759 TTTCCTAGAAGGAAAGGGAATGG - Intergenic
1020798193 7:12701215-12701237 TTTCCTCCAGGGAATGGGGCAGG + Intergenic
1021229062 7:18063559-18063581 TTAAATACAGGGAAAGGTGGAGG - Intergenic
1023627465 7:42130185-42130207 TTTCCTTTAGGGAAATAGGGTGG - Intronic
1024559813 7:50633190-50633212 TCTCCTACAGAGAAATGGGGAGG - Intronic
1024758198 7:52562005-52562027 TATCCTGCAGGGAAAATGGGTGG + Intergenic
1025068173 7:55875294-55875316 TATACTTCAGGGAATGGGGGAGG - Intergenic
1025947936 7:66119051-66119073 CTTCCTACTGGGTAAGGGGCAGG - Intronic
1026269311 7:68822621-68822643 TCTCCTCCAGGGAAAGGGCAGGG + Intergenic
1026480321 7:70773172-70773194 TTGCCTACAAGGAGAAGGGGGGG - Intronic
1026570039 7:71521365-71521387 CTTCCTGCTGGGAAAGGAGGTGG - Intronic
1027291251 7:76713386-76713408 TTTTCTGCAGTGAAAGGGGAGGG + Intergenic
1028773561 7:94655652-94655674 TTTGCTACAGGGATCGGGAGAGG + Intronic
1029118462 7:98250840-98250862 TCTGCTACAGTGAAAGGGAGGGG + Intronic
1029423689 7:100484181-100484203 TTTGGAACAGGGGAAGGGGGAGG + Intronic
1032122735 7:129168754-129168776 ATTCCTACAGGGTAAGAGGTAGG + Exonic
1032280403 7:130495358-130495380 TTTCCTACAGGATGAGGGAGTGG + Exonic
1034377574 7:150659495-150659517 GTTCCCAAAGGGAAAGGGGATGG - Intergenic
1034696523 7:153059000-153059022 ATTCATACTGGGAAAGGGAGGGG + Intergenic
1035463202 7:159058993-159059015 TTACCTACAGGCACAGGGTGAGG + Intronic
1036640436 8:10580097-10580119 TTCCGGGCAGGGAAAGGGGGAGG + Intergenic
1037623462 8:20587588-20587610 GTTCCTACAGAGACAGGGTGGGG + Intergenic
1037981148 8:23255237-23255259 TTTCCCACAGGAAAAGGCTGAGG + Exonic
1041549780 8:59087521-59087543 TTTGCTACAGAGTAAAGGGGGGG - Intronic
1042737536 8:72005435-72005457 AGTCCTACACTGAAAGGGGGAGG - Intronic
1046411859 8:113855345-113855367 TTTCCAAGTGGTAAAGGGGGTGG + Intergenic
1046937379 8:119897630-119897652 ATTCCTACAAAGAAAGTGGGAGG - Intronic
1048504263 8:135006572-135006594 TTTCCTGCAGAGAGAGGAGGAGG + Intergenic
1048994915 8:139788335-139788357 TTTCCCACAGGGAAAAGGAGTGG + Intronic
1049771326 8:144383387-144383409 TTTCCTACATGGGAAGGTGCTGG + Intronic
1050602307 9:7265356-7265378 TATCCAAAAGGGAAAGGGAGAGG - Intergenic
1050808400 9:9713715-9713737 TTTATTACAGGGACAGTGGGAGG + Intronic
1051648414 9:19294387-19294409 TGTCATACAAGGAAAGGGTGTGG + Intronic
1052881473 9:33603266-33603288 ATTCCTACAGGGTAAGGCTGGGG - Intergenic
1052966900 9:34347169-34347191 TTTCCTCCAGAGAATGGGGCTGG + Intergenic
1053307754 9:36995955-36995977 CTTCCTAAAGGCAAAGGAGGAGG + Intronic
1053494845 9:38542573-38542595 ATTCCTACAGGGTAAGGCTGGGG + Exonic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1055573330 9:77639213-77639235 TCTACCATAGGGAAAGGGGGTGG - Intronic
1055914960 9:81391520-81391542 TGTCCTTTAGGGAAAGGGGCAGG + Intergenic
1056829331 9:89902108-89902130 TTTCCTACTTGGGAAGGGTGTGG + Intergenic
1059679760 9:116574725-116574747 TTTGCTACCTGCAAAGGGGGAGG - Intronic
1061258396 9:129466036-129466058 TTCCCTCCAGGGAAGGGCGGGGG - Intergenic
1062157712 9:135062734-135062756 TTTCCTTCTGGGAGAGGGAGAGG - Intergenic
1062160731 9:135078225-135078247 TTACCTACAGTGGAAGCGGGAGG - Intronic
1062384134 9:136302388-136302410 CCTCCTGCAGGGACAGGGGGTGG - Intronic
1062539953 9:137037189-137037211 TTAGCCACAGGGAAAGCGGGTGG - Exonic
1185547908 X:960621-960643 TCTCTTGCAGGGAAGGGGGGGGG + Intergenic
1187433993 X:19250158-19250180 TGTCCTACAGGGAATCGGGATGG + Intergenic
1187736677 X:22312007-22312029 TTGCATAGAGGGAAAGGAGGAGG + Intergenic
1189065589 X:37804987-37805009 TATCCTGAAGGGAAATGGGGAGG - Exonic
1189380670 X:40500235-40500257 TTTCCTGGAGGGCAAGGTGGTGG + Intergenic
1189835756 X:45020268-45020290 TTTCCTAGAGGAAAACAGGGTGG - Intronic
1190296226 X:49029521-49029543 GTTCCTATAGGGAAGGGGTGGGG + Exonic
1193393461 X:80956711-80956733 TTTCCTATAGGGAAAAGGAAAGG + Intergenic
1197131773 X:123013993-123014015 TTTACTGAAGGGACAGGGGGAGG + Intergenic
1198082075 X:133249472-133249494 TTTCTTACAGGAAAAGGGGGAGG + Intergenic
1199526794 X:148801812-148801834 ATTCCTACTGTGAAAGGAGGTGG - Intronic
1200804829 Y:7422497-7422519 TTTCCTTCTGGGGAAGGGAGAGG - Intergenic