ID: 1148859964

View in Genome Browser
Species Human (GRCh38)
Location 17:50599658-50599680
Sequence AACTCTTGGCCTCCCGCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148859964_1148859971 12 Left 1148859964 17:50599658-50599680 CCTGGAGCGGGAGGCCAAGAGTT 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1148859971 17:50599693-50599715 CAGACACACTGCAGGTGCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 293
1148859964_1148859967 4 Left 1148859964 17:50599658-50599680 CCTGGAGCGGGAGGCCAAGAGTT 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1148859967 17:50599685-50599707 TGACCTGCCAGACACACTGCAGG 0: 1
1: 0
2: 2
3: 12
4: 186
1148859964_1148859970 11 Left 1148859964 17:50599658-50599680 CCTGGAGCGGGAGGCCAAGAGTT 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1148859970 17:50599692-50599714 CCAGACACACTGCAGGTGCCAGG 0: 1
1: 0
2: 3
3: 35
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148859964 Original CRISPR AACTCTTGGCCTCCCGCTCC AGG (reversed) Exonic
901205668 1:7494456-7494478 TGCTCTTGGCTTCCCGCTCATGG - Intronic
902667438 1:17949371-17949393 AGCTCTTTTCTTCCCGCTCCCGG - Intergenic
902733478 1:18384719-18384741 ATCTCTGAGCCTCCCGCTGCTGG - Intergenic
903004944 1:20292326-20292348 AGCTCTGGTCCTCCTGCTCCTGG + Intronic
903295908 1:22342959-22342981 ACCTCCTGGACTCCCACTCCAGG + Intergenic
903820730 1:26100522-26100544 AACTCCTGGCCTCGAACTCCTGG - Intergenic
904264387 1:29310074-29310096 AGCTCTTGGCCTCTCTCTCGTGG + Intronic
905379891 1:37554300-37554322 AACTCCTGGACTTCCGCTTCCGG + Exonic
905512662 1:38534962-38534984 CCCTCTTGGTCTCCCGCGCCTGG + Intergenic
906323825 1:44832195-44832217 AGCACTTGGCCTCCACCTCCAGG - Exonic
907258155 1:53196086-53196108 AACCCTTGTCCTCCGGCTCTAGG - Intergenic
908569077 1:65389785-65389807 AACTCCTGGCCTTCCTATCCTGG - Intronic
908683232 1:66685463-66685485 AACTCTTTGCCTCCAGCCTCTGG - Intronic
908845872 1:68323587-68323609 TGCCCTTGGCCTCCGGCTCCTGG - Intergenic
911644353 1:100322196-100322218 AACTCCTGGCCTTGAGCTCCTGG + Intergenic
913675237 1:121134168-121134190 AACTCCTGGCCTCAAACTCCTGG + Intergenic
914027073 1:143921787-143921809 AACTCCTGGCCTCAAACTCCTGG + Intergenic
915325732 1:155080446-155080468 AGTTCTTGGAGTCCCGCTCCGGG - Intronic
917662069 1:177186633-177186655 AACTCTTGGCTTCCAGATCCTGG + Intronic
917817333 1:178724884-178724906 ACCGCCTGGCCACCCGCTCCCGG - Intergenic
918137583 1:181688175-181688197 AACTCTCGCCCTCCCACTCAAGG + Intronic
920211506 1:204332013-204332035 AACTCCTGGCAGCCTGCTCCAGG + Intronic
920462598 1:206153005-206153027 AACTCCTGGCCTCAAACTCCTGG + Intergenic
923545250 1:234918948-234918970 TACTCTTGCCCTCCAGCTTCTGG + Intergenic
1063068093 10:2629908-2629930 ACCTCGTGGCCGCCCGCCCCGGG + Intergenic
1067709249 10:48635445-48635467 CACTGATGGCTTCCCGCTCCAGG + Intronic
1067728279 10:48790097-48790119 AACTCTGGTCCTCCCGACCCTGG - Intronic
1070914627 10:80144913-80144935 AACTGCTGGGCTCCAGCTCCAGG - Exonic
1074683800 10:115939174-115939196 AACTCTTGGCCTCCAGCCCAGGG + Intronic
1076165880 10:128282177-128282199 AACGCATGGCCTGCTGCTCCTGG + Intergenic
1081678075 11:44982628-44982650 CTGTCTCGGCCTCCCGCTCCAGG - Intergenic
1081791360 11:45788754-45788776 AACTCCTGGCCTCGAACTCCTGG + Intergenic
1082654821 11:55840994-55841016 AACTCTTGGACTCAAACTCCTGG + Intergenic
1083287529 11:61669959-61669981 AACTCTTGACTCCCCGCTCAGGG - Intergenic
1083430834 11:62612885-62612907 TACTCCCGGCCTCCGGCTCCAGG + Exonic
1084311611 11:68319563-68319585 AGCTCCTGGCCTCCAACTCCTGG + Intronic
1084883568 11:72189131-72189153 AACTCATGGACCCCCTCTCCCGG - Intergenic
1087002304 11:93433442-93433464 AACTCTTAACTTCCAGCTCCTGG - Intronic
1087150954 11:94859133-94859155 AAGTCTTGGCCTCCTGGTCTAGG - Intronic
1092257797 12:6936783-6936805 AACTCTGGGCCCCCTCCTCCTGG + Exonic
1092980892 12:13793195-13793217 AGCTCCTGGCCTCGAGCTCCTGG - Intronic
1093184239 12:16001725-16001747 AACTCATGACCTCGCCCTCCTGG - Intronic
1096492681 12:52021468-52021490 ACCTGGTGGCCTCCTGCTCCTGG - Intergenic
1097020998 12:56020845-56020867 AACTCTTTCCCTCCTCCTCCAGG - Intronic
1098487649 12:71040105-71040127 ATCTCTTTTCCTCCTGCTCCTGG + Intergenic
1101595402 12:106160238-106160260 AACTCCTGGCCTCAAGCTCCTGG + Intergenic
1102283776 12:111638605-111638627 CACTCTTGGACTTCCCCTCCTGG + Intergenic
1103852243 12:123940802-123940824 GACTCTTGGCTTCCCTCCCCTGG - Intronic
1104703507 12:130925100-130925122 AACTCTTGCCCTCTAGCTTCTGG - Intergenic
1104837899 12:131803617-131803639 AACTCCTGGCCTCGAACTCCTGG - Intergenic
1105623100 13:22087901-22087923 CACTCTTGGCCTCCTGACCCAGG + Intergenic
1107513481 13:41107509-41107531 AGGTCTGGGCCTCCGGCTCCAGG + Intergenic
1108615755 13:52130004-52130026 AACTTTTGGACTCCTGCTACGGG - Intergenic
1110983131 13:81928360-81928382 AACTCCTGGACTCACCCTCCTGG - Intergenic
1112310450 13:98313415-98313437 AAGCCCTGGCATCCCGCTCCTGG - Intronic
1114295464 14:21325228-21325250 AACTCTTCTCCACCAGCTCCTGG - Exonic
1115639823 14:35327207-35327229 AACTCCTGGTCTCAAGCTCCTGG - Intergenic
1122419035 14:101563960-101563982 GCCTCTTGCCCACCCGCTCCAGG + Intergenic
1122727974 14:103771982-103772004 ATCTCTTTGCCCCCCACTCCTGG + Intronic
1124924358 15:34056805-34056827 AACTCCTGGCCTCGAACTCCTGG - Intronic
1125062156 15:35437513-35437535 GGCTTTTGGCCTCCCTCTCCTGG + Intronic
1125880815 15:43193113-43193135 AACTCCTGACCTCCGCCTCCTGG - Intronic
1126185847 15:45829765-45829787 AGATCTGGGCCTCCAGCTCCAGG - Intergenic
1126781343 15:52141489-52141511 AACTCTTGGCCTCGAACTCGTGG + Intronic
1127494567 15:59497644-59497666 AACTCCTGGCCTCAAACTCCTGG - Intronic
1127494570 15:59497658-59497680 AACTCCTGGCCTCAAACTCCTGG - Intronic
1127534727 15:59879496-59879518 AACTCATGGCAACCTGCTCCAGG - Intergenic
1129233930 15:74212497-74212519 CTCTCTTGGCCTCCTGCTCCGGG - Intergenic
1131453254 15:92563509-92563531 AACTCTTAACCCCCAGCTCCTGG - Intergenic
1132156361 15:99498390-99498412 CTCTCTTGGCCTCCAGCTGCAGG + Intergenic
1135074970 16:19385279-19385301 ATCCCTTTGCCTCCAGCTCCTGG + Intergenic
1135161200 16:20098016-20098038 AGCTTTTGGCCTCTAGCTCCTGG + Intergenic
1135171331 16:20186644-20186666 TTCTCTTGGCCTCTAGCTCCTGG + Intergenic
1138228041 16:55315733-55315755 CAGTCATGGCCTCCTGCTCCTGG - Intergenic
1142096967 16:88245401-88245423 GGCTCTTGGCCTCTCCCTCCTGG + Intergenic
1144386187 17:14751208-14751230 TGCTCTGGGCCTCCTGCTCCAGG + Intergenic
1144565761 17:16357863-16357885 AACTCCTGGCCTCAAACTCCTGG + Intergenic
1145272072 17:21410104-21410126 ACGTCTTTGCCTCCCACTCCTGG + Intronic
1145310280 17:21697566-21697588 ACGTCTTTGCCTCCCACTCCTGG + Intronic
1148859964 17:50599658-50599680 AACTCTTGGCCTCCCGCTCCAGG - Exonic
1149539664 17:57459466-57459488 AACTTTTGACCTCTGGCTCCAGG + Intronic
1151554683 17:74840713-74840735 AACTGTTGGCCACCAGCCCCTGG - Intergenic
1151660752 17:75516754-75516776 AGCTCTTCGCCGCCCGCTCGCGG + Exonic
1151751768 17:76043038-76043060 AACTCATGGCCTCGAACTCCTGG - Intronic
1151876458 17:76870127-76870149 AACTCTTGCCCTCCAGGTCTCGG + Intronic
1152643254 17:81457838-81457860 AACCCCTGCCCTCCCCCTCCTGG - Intronic
1154473459 18:14726614-14726636 AACTCCTGGTCTCCAACTCCTGG + Intergenic
1158696816 18:59710807-59710829 ACCTCCTGGCTTCCAGCTCCGGG + Intergenic
1160410677 18:78673623-78673645 AGCTCTGGTCCTCCGGCTCCGGG - Intergenic
1163022935 19:14493213-14493235 AACTCTTGTCTTCCAGCTTCAGG + Intronic
1163588655 19:18177827-18177849 AACTCATGGCCTTCACCTCCAGG + Exonic
1163658005 19:18558949-18558971 AGCTATGGGCCTCCCTCTCCAGG + Intronic
1164830039 19:31313408-31313430 CACACTTGGCTTCCAGCTCCCGG - Intronic
1166338260 19:42121969-42121991 CACTCTTGGGCTCCCACCCCAGG - Intronic
1167473693 19:49688668-49688690 AACTCTTTTCATCCCTCTCCTGG + Exonic
926998652 2:18768821-18768843 TATTCTTGGCCTCCTGGTCCTGG + Intergenic
928261101 2:29767498-29767520 AACTCAGGGCCTCTGGCTCCTGG + Intronic
931376839 2:61715557-61715579 AACTCCTGGCCTCGAACTCCTGG + Intergenic
936886431 2:117316786-117316808 AACTTTTGGCCTCAAACTCCTGG - Intergenic
941340995 2:164302990-164303012 AACTCTTGGCCCACACCTCCTGG - Intergenic
941384772 2:164840787-164840809 AACTTTTGCCCTCCCTCCCCAGG + Intronic
942077226 2:172367126-172367148 AACTCTAGTCCTTCCGGTCCTGG + Intergenic
946832962 2:223744101-223744123 AACTCCTGACCTCCAACTCCTGG + Intergenic
947073474 2:226317120-226317142 ATGTCCTGGCCTCCTGCTCCAGG + Intergenic
1169011409 20:2254026-2254048 AACTCCTGGCCTCGAACTCCTGG + Intergenic
1170596102 20:17806959-17806981 AATTCTTGGCCTGCCCCCCCGGG - Intergenic
1172383238 20:34514353-34514375 AACTCTAAGCCTGCCACTCCGGG + Intergenic
1172635839 20:36409259-36409281 AACTCTTGGTCTTCAACTCCTGG + Intronic
1174716728 20:52766764-52766786 AACTCTGGCCATCCGGCTCCAGG - Intergenic
1175389509 20:58617877-58617899 ACCTCTGGGCCTCCCGCTGATGG - Intergenic
1176801024 21:13431251-13431273 AACTCCTGGTCTCCAACTCCTGG - Intergenic
1177836874 21:26194340-26194362 AACTCCTGGCCTCAAACTCCTGG + Intergenic
1178392178 21:32207834-32207856 ACCTCTTGGCCTCCTGGGCCCGG + Intergenic
1178626414 21:34222567-34222589 AACTCTTCTCCCCCAGCTCCAGG - Intergenic
1181735218 22:24876281-24876303 AAGGCTTGGCCTCCTGCTCTGGG + Intronic
1182711319 22:32325145-32325167 AACTCTTGGCCCCTCGCACTAGG + Intergenic
1182813807 22:33140129-33140151 AACTCTGGGCTGCCCTCTCCTGG + Intergenic
1183197253 22:36361961-36361983 AATTCTTGGCCTCAGCCTCCCGG - Intronic
1183414892 22:37676357-37676379 AACTCTTGCCCACCCACTCGGGG + Intronic
1184979436 22:48085504-48085526 CATTCTTGGCCTCCACCTCCAGG - Intergenic
950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG + Intronic
950761740 3:15235943-15235965 AACTCCTGGCCTCGAACTCCTGG - Intronic
952715752 3:36478844-36478866 AACTCCTGGCCTCAAACTCCTGG + Intronic
952859464 3:37800939-37800961 AACTCCTGGCCTCGAACTCCTGG - Intronic
953138883 3:40209149-40209171 ATCTGGTGGTCTCCCGCTCCCGG - Intronic
963897885 3:150705337-150705359 AACTCTCGGTCTCAAGCTCCTGG + Intergenic
963988600 3:151627226-151627248 AACTCCTGGCCTCAAACTCCTGG + Intergenic
964752566 3:160065803-160065825 AACTCCTGGCCTCGAACTCCTGG - Intergenic
966165059 3:177007926-177007948 CACCCTTTGCCTCCAGCTCCCGG + Intergenic
966964215 3:184972835-184972857 AACTCTTCGCCTGCCCTTCCAGG + Intronic
970824022 4:20252364-20252386 CTTTCCTGGCCTCCCGCTCCAGG - Intergenic
972467299 4:39369605-39369627 AACTCCTGGCCTCGAACTCCTGG - Intergenic
975485795 4:74933281-74933303 AACTCCTTGCCGCCCGCCCCGGG + Exonic
977253323 4:94712789-94712811 AACTCCTGGCCTCAAACTCCTGG - Intergenic
977664532 4:99630397-99630419 CACTCTTGCCCTCTGGCTCCTGG - Intergenic
978648327 4:110969422-110969444 AACTCCTGGCCTCAAACTCCTGG + Intergenic
979127742 4:116997864-116997886 AACTCTTGGCCTCAAACTCCTGG - Intergenic
982046187 4:151448470-151448492 CCCCCTTGGCCTCCAGCTCCTGG + Intronic
982635390 4:157889321-157889343 AACTGTTGGCCTTTCTCTCCTGG + Intergenic
983353841 4:166630316-166630338 AACTCATGGCCTCTGCCTCCAGG + Intergenic
985119662 4:186627475-186627497 ATCTCTTGGCCTCTGGGTCCCGG + Intronic
989685171 5:44077485-44077507 AAGTCTTGGCCTTCTGCTCTTGG + Intergenic
999218690 5:149957540-149957562 AACTCCTGGCCTCAAACTCCTGG - Intergenic
999869127 5:155731007-155731029 TCCTCTTGGCCCCCAGCTCCTGG - Intergenic
1000991873 5:167919574-167919596 ACCTCTTCGCCTCCCGTTCTGGG - Intronic
1001487291 5:172128706-172128728 ACCTCTTAGCTTCCAGCTCCTGG + Intronic
1002605868 5:180382391-180382413 GACTCTTGGCCTCCCAAACCAGG + Intergenic
1005816875 6:29560246-29560268 AACTCTTTTCCTCCCCATCCTGG + Intronic
1008059868 6:46985596-46985618 AACTCTGGGCCTCTCCCTCCAGG - Intergenic
1009576228 6:65465252-65465274 AACTCCTGGCCTCAAACTCCTGG - Intronic
1015181445 6:130366035-130366057 AACTTTTCCCCTCCCGTTCCCGG + Intronic
1015638369 6:135303636-135303658 AACTCTGGGCCTCCAATTCCTGG - Intronic
1020045475 7:5037210-5037232 AACTCCTGGCCTCAAACTCCTGG + Intronic
1021275066 7:18640267-18640289 AACTCTTGGGCTCAAACTCCTGG - Intronic
1022648706 7:32255418-32255440 AACACTTGGCCTCTGGCTTCAGG + Intronic
1023595572 7:41826367-41826389 AACTCTTGTCCTCCAGGTCAGGG - Intergenic
1025241911 7:57283806-57283828 AACTCCTGGCCTCAAACTCCTGG + Intergenic
1027933012 7:84564161-84564183 AACTCCTGGCCTCAAACTCCTGG + Intergenic
1030659751 7:112206504-112206526 AGTTCTTGGCCTCCCCATCCCGG + Intergenic
1033034858 7:137864879-137864901 AACTTTAGGCATCCGGCTCCAGG + Intergenic
1033372787 7:140726516-140726538 AGCTCTTGTCCTCCCTCTACAGG - Intronic
1034336953 7:150330008-150330030 CACCCTTGGCCGCCTGCTCCAGG - Exonic
1036015857 8:4783620-4783642 TTCACTTGGCCTCCTGCTCCAGG + Intronic
1037673728 8:21037049-21037071 CACTGCTGGCCTGCCGCTCCGGG - Intergenic
1038420501 8:27431195-27431217 AAATGTTGGCCTCCAGCTCTGGG + Intronic
1040440351 8:47435221-47435243 AACTCCTGGCCTCGAGCTCCTGG + Intronic
1041422186 8:57680064-57680086 AACTCCTGGGCTCAAGCTCCAGG - Intergenic
1049083054 8:140457657-140457679 AGGTCGTGGGCTCCCGCTCCGGG - Intronic
1049337548 8:142094472-142094494 ACCTCCGGGGCTCCCGCTCCAGG - Intergenic
1056824128 9:89865056-89865078 AACTCCTGGCATCCCACTCAGGG + Intergenic
1057024898 9:91727433-91727455 AACTCTTTGTCTCCCTCTACAGG + Intronic
1059405285 9:114095332-114095354 AACTCTTGCTCTCCCTCCCCAGG - Exonic
1060411449 9:123403054-123403076 AACACTTGGCCTCCTTCACCAGG + Intronic
1061826521 9:133261459-133261481 AACTCTTGTGCTCACGCTGCTGG - Intronic
1062430595 9:136525374-136525396 ACCTCCTGGCCTTGCGCTCCGGG + Intronic
1187174374 X:16882883-16882905 AACTCTTGGGCTCAGGCTCCAGG + Intergenic
1189090740 X:38080086-38080108 ATTTCTAGGCCTCCAGCTCCAGG + Intronic
1190169261 X:48098916-48098938 AACTCCTGGCCTCAAACTCCTGG + Intergenic
1190169264 X:48098930-48098952 AACTCCTGGCCTCAAACTCCTGG + Intergenic
1192777074 X:74256258-74256280 ATCTTGTGGCCTCCAGCTCCTGG + Intergenic
1196107141 X:111908925-111908947 AACTCCTGGCCTCAAACTCCTGG - Intronic
1196899515 X:120368975-120368997 AACTCTAGGGCGCCCACTCCTGG + Intronic
1200066031 X:153504477-153504499 CCCTCTCCGCCTCCCGCTCCAGG + Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic