ID: 1148863029

View in Genome Browser
Species Human (GRCh38)
Location 17:50614391-50614413
Sequence CTCCCACGAAGCCACAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148863029_1148863035 26 Left 1148863029 17:50614391-50614413 CCTTCTCTGTGGCTTCGTGGGAG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1148863035 17:50614440-50614462 ACATGTGCCCCAAGTTGGCCTGG 0: 1
1: 0
2: 3
3: 16
4: 245
1148863029_1148863034 21 Left 1148863029 17:50614391-50614413 CCTTCTCTGTGGCTTCGTGGGAG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1148863034 17:50614435-50614457 CAAGAACATGTGCCCCAAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148863029 Original CRISPR CTCCCACGAAGCCACAGAGA AGG (reversed) Intronic
900936759 1:5770948-5770970 CTGGCCCAAAGCCACAGAGAAGG + Intergenic
904377416 1:30090522-30090544 CTCTCTGGAAGCCACAGACATGG - Intergenic
905976894 1:42182352-42182374 CTCCCACTAAGCCCCAAAGGAGG + Intronic
906520039 1:46461429-46461451 TCCCCAGGAACCCACAGAGAAGG - Intergenic
906771794 1:48491719-48491741 CTTCCATGAAGCCTGAGAGAAGG + Intergenic
906787555 1:48629239-48629261 CACCCACAAGGCCACAGACAGGG - Intronic
906935041 1:50207397-50207419 CTCCCACTATGACACACAGATGG + Intergenic
907908106 1:58803158-58803180 CACCCACCTAGCCACAGAGTGGG - Intergenic
908707216 1:66971356-66971378 ATCTCAAGAAGCCACAAAGAAGG + Intronic
911278594 1:95895250-95895272 ATCCCAGGAAGGCACAGAAAGGG + Intergenic
911652049 1:100400445-100400467 TTACCAACAAGCCACAGAGAAGG - Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
921931303 1:220756496-220756518 CTGCCACGAAAACACAGAGCTGG + Intronic
922747246 1:228051208-228051230 CAGCCAGGCAGCCACAGAGACGG + Intronic
922885602 1:229018234-229018256 CTCTCACTCTGCCACAGAGATGG - Intergenic
923297126 1:232604895-232604917 CTCCCCAGAAGCCAAGGAGATGG + Intergenic
923501036 1:234564623-234564645 CTCCCACCAAGCCCCTAAGAAGG - Intergenic
923899181 1:238306421-238306443 TTCACATGAAGCCAAAGAGAAGG - Intergenic
1063335389 10:5207887-5207909 CTTCCACAAAGCCACAGAGTTGG - Intronic
1064769530 10:18710231-18710253 TTCCCGCGCAGCCGCAGAGAAGG - Intergenic
1068198182 10:53745687-53745709 CTCCCAAGAAGCCAAGCAGAGGG - Intergenic
1069331389 10:67297583-67297605 TCCCCACGAAGCCATAGATATGG + Intronic
1069345515 10:67464909-67464931 CTCCCCCGAAGCCTCTAAGAAGG - Intronic
1069768368 10:70880916-70880938 CTGCCAAGAACCTACAGAGAAGG - Exonic
1070809471 10:79290403-79290425 CTTCCATGTAGCCACAGAAAAGG - Intronic
1070997291 10:80796946-80796968 CTCCCAAGAAGCCACGGGCAAGG - Intergenic
1073945316 10:108743432-108743454 CTCTGCAGAAGCCACAGAGAGGG + Intergenic
1074184379 10:111088107-111088129 CTCCCAGGAGCCCCCAGAGAGGG + Intergenic
1075627612 10:123973804-123973826 CTACCACAAAGCCAGAAAGAAGG - Intergenic
1075655538 10:124158734-124158756 CTACCACGCAGCCATAGGGATGG - Intergenic
1075777317 10:124997246-124997268 TTCCCACAAGGCCACAGAGCTGG + Intronic
1076692708 10:132231886-132231908 CTCCCACGGAGCCGCCCAGAGGG + Intronic
1076896931 10:133317604-133317626 CTCCCCCCCAGACACAGAGATGG + Intronic
1076897004 10:133317848-133317870 CTCCCCCCCAGACACAGAGATGG + Intronic
1076897043 10:133317981-133318003 CTCCCCCCCAGACACAGAGATGG + Intronic
1076897132 10:133318312-133318334 CTCCCCCCCAGACACAGAGATGG + Intronic
1077077049 11:706592-706614 CCCCCACCAAGCCCCAGAGCTGG - Intronic
1079720138 11:23800810-23800832 CTCCCAAGAAGTCAGGGAGAAGG + Intergenic
1080731460 11:34959274-34959296 CTCCCAAGAAGATACATAGATGG + Intronic
1081836706 11:46161426-46161448 CTCCCACGTGGACACAGAGAGGG + Intergenic
1081929523 11:46859114-46859136 CTCCCTGGATGACACAGAGACGG - Exonic
1083617537 11:64034064-64034086 CCCACACCAAGCCACAGAGCTGG - Intronic
1084352166 11:68610066-68610088 CTCCCAGGAAGCAACAGGCAAGG - Intronic
1085272669 11:75279457-75279479 TTCCCAGCATGCCACAGAGACGG - Intronic
1085806766 11:79643568-79643590 CTCCCATGAAGCCACACAAAGGG - Intergenic
1089560623 11:119341422-119341444 CTCCCTGGGAGCCCCAGAGAAGG + Exonic
1090534436 11:127625308-127625330 CACCCACCAGGCCACTGAGAGGG - Intergenic
1090831415 11:130423373-130423395 CTCCCTGGTAGCCACAGAGCAGG + Intronic
1091855728 12:3737764-3737786 CTCCCACAAGGCCACTGGGATGG + Intronic
1095126151 12:38479887-38479909 CTCCCCCAAAGCCACAGAGCTGG + Intergenic
1097379913 12:58882497-58882519 CTCCCAACAAGCCTCAGAGTTGG + Intronic
1101680704 12:106961584-106961606 CTTCCAGGAAGCCAAAGAGAAGG + Intronic
1104510200 12:129370421-129370443 CTCCCACCAAGCCTCACAGCTGG - Intronic
1108939291 13:55932248-55932270 ATTCCACGAACCCAAAGAGAAGG + Intergenic
1110688630 13:78405017-78405039 CTTACACAGAGCCACAGAGAGGG + Intergenic
1111454390 13:88461457-88461479 CTCCTACTATCCCACAGAGATGG + Intergenic
1112290670 13:98142595-98142617 CTCCCCCGGAGCCACAGGCACGG - Exonic
1113905135 13:113815786-113815808 GTCTCACCCAGCCACAGAGAGGG + Exonic
1114770173 14:25421388-25421410 CTCCCACTAGTGCACAGAGAAGG - Intergenic
1114801295 14:25778618-25778640 CTCCCTAGAAGCCAAACAGATGG + Intergenic
1119541051 14:75438441-75438463 CTCCCACCACCCCAGAGAGATGG - Intronic
1119644957 14:76341410-76341432 CTTCCAGGAGGCCACAGGGAGGG - Intronic
1119654607 14:76408223-76408245 CTTCTACGAAGACACAAAGAAGG + Intronic
1124354521 15:28984887-28984909 CTCCCCCCAACCCCCAGAGATGG - Intronic
1125888284 15:43245847-43245869 CTGCCACAGAGCCACAGAGCAGG - Intronic
1127043562 15:55002801-55002823 CTCCTGCAAAGCCACAGACAGGG - Intergenic
1131077482 15:89504416-89504438 GTCCCTCAAAGCCACAGACAGGG + Intergenic
1132457820 16:33827-33849 TTCCCAGGAAGCCCCAGAGTTGG + Intergenic
1133500166 16:6358118-6358140 CTTCCACAAAGCCACACAGTTGG - Intronic
1134372532 16:13638654-13638676 CTCTCTCAAAGGCACAGAGAGGG + Intergenic
1134809931 16:17158675-17158697 ATCCCACGCAGACACAGCGAAGG + Intronic
1141131846 16:81442884-81442906 CTCCTACCAAGGCAAAGAGATGG - Intergenic
1141445606 16:84055890-84055912 CTCCCAGGAAGGCAGAGACAGGG + Intronic
1142682611 17:1559201-1559223 CTACCACAAAGCCACCAAGAGGG + Intronic
1143983578 17:10891943-10891965 CTACCATGGAGCCACAGTGATGG - Intergenic
1144467575 17:15508585-15508607 CACCAGCGAAGCCACAGGGAGGG - Intronic
1145757660 17:27404419-27404441 CCCCCACAAAGCCACAGAGTTGG - Intergenic
1147595632 17:41715486-41715508 CTTCCAAGAAGCTTCAGAGAAGG - Exonic
1147881383 17:43656367-43656389 CTGCCACGAAGCCACACCCAGGG - Intronic
1148196823 17:45720008-45720030 CTCCCAGGAAACCACAGTGTGGG + Intergenic
1148479035 17:47947983-47948005 GTCCCTTGTAGCCACAGAGAAGG - Exonic
1148863029 17:50614391-50614413 CTCCCACGAAGCCACAGAGAAGG - Intronic
1150457512 17:65319095-65319117 CTCCCAAGAGGCCTCAGATAAGG + Intergenic
1152743356 17:82028227-82028249 CTCCCAGGAAGCTGCAGAGCGGG + Exonic
1152809337 17:82374184-82374206 CTCCCAGGAGGCCACTGTGATGG - Intergenic
1152961824 18:84551-84573 TTCCCAGGAAGCCCCAGAGTTGG + Intergenic
1155309577 18:24510449-24510471 CTCCTACTAAGGCACAGAGAGGG + Intergenic
1156378183 18:36533066-36533088 CTTCCTCGAGGCCACAGACATGG + Intronic
1159172562 18:64790217-64790239 CTCTTACCAAGCCATAGAGATGG + Intergenic
1159443235 18:68508375-68508397 TTCCCAGGAAGCCACGTAGAGGG - Intergenic
1161312070 19:3600307-3600329 CGCCCATGAAGCGACAGAGACGG + Exonic
1163688420 19:18725330-18725352 CTCCCTGGAGGCCACAGGGAGGG - Intronic
1164504111 19:28843997-28844019 CTCACAAGCAGCCAAAGAGATGG - Intergenic
1165002700 19:32778287-32778309 CTTCCACGAGCCCACAGAGTTGG + Intronic
1165480084 19:36058012-36058034 CTCCCAACAAGCCACGAAGAAGG - Intronic
1168253035 19:55151682-55151704 CTCCCCCAAAGCCACACAGCAGG - Intergenic
1168643839 19:58047314-58047336 CTCTCCAGAGGCCACAGAGATGG - Intronic
925109532 2:1322327-1322349 CTCCCCCAAAGCCAGAGACACGG + Intronic
925243048 2:2350361-2350383 TTCCCACTAACCCACAGAGGTGG - Intergenic
926158970 2:10474847-10474869 CTCTCAGGAGGCCACAGAGGAGG + Intergenic
926208070 2:10848018-10848040 CTCCCACCAAGACACACACAAGG + Intronic
926685189 2:15692559-15692581 CTCCCAATAAGCCACAGAGAAGG - Intronic
930700910 2:54456969-54456991 CACCCGCGGGGCCACAGAGAGGG - Intronic
931077851 2:58736266-58736288 ATCCCAGGAAGCCAAAGTGAAGG - Intergenic
933377403 2:81497571-81497593 CTCCTACCATGCCATAGAGAAGG + Intergenic
937906773 2:127056327-127056349 CTGCCACTATCCCACAGAGAGGG + Intronic
940691610 2:156926164-156926186 ACCCCACAAAGCCACAGAGATGG - Intergenic
943672288 2:190676075-190676097 CTCCCCAGAAGCCATATAGAAGG - Intronic
943675571 2:190713238-190713260 CTCCCAGCAATCCACAGAGGGGG + Intergenic
945297336 2:208183619-208183641 ATCCCAAGAAGCTTCAGAGAGGG + Intronic
945981467 2:216315907-216315929 CTCCCAGGAAGCGAAATAGATGG - Intronic
946011541 2:216568406-216568428 GTCTCACCAAGCAACAGAGAAGG - Intronic
947589020 2:231374240-231374262 TACCAAGGAAGCCACAGAGAGGG + Intronic
948316305 2:237030726-237030748 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316323 2:237030785-237030807 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316341 2:237030844-237030866 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316359 2:237030903-237030925 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316377 2:237030962-237030984 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316395 2:237031021-237031043 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316423 2:237031110-237031132 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316454 2:237031232-237031254 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316470 2:237031292-237031314 CTCACCCTAGGCCACAGAGAAGG + Intergenic
948316487 2:237031352-237031374 CTCACCCTAGGCCACAGAGAAGG + Intergenic
949075269 2:242053326-242053348 CTCCCTCGAAGCTCCACAGAGGG - Intergenic
1169681455 20:8218479-8218501 CTGGCCCGAAGCCACAGAGCTGG - Intronic
1172222933 20:33286097-33286119 CTGCCAGCAAACCACAGAGAAGG - Exonic
1172598931 20:36170071-36170093 CTCTCACTAGGCCACAGAAAGGG - Intronic
1175159157 20:56995224-56995246 CTCCCAGGAGGCCACAGCCATGG - Intergenic
1175674973 20:60938471-60938493 CTCCCTAGAAGCCACTGGGAAGG + Intergenic
1176294772 21:5065602-5065624 CCACCAGGAAGCCACAGACAAGG + Intergenic
1177237778 21:18415142-18415164 CTCCAAAGAAGACACAGAAATGG - Intronic
1178805962 21:35839315-35839337 CACCCACAAAGCCACACAGCTGG + Intronic
1179437635 21:41373383-41373405 CTCCCAACAAGGCACAGAGAGGG - Intronic
1179542707 21:42093960-42093982 CACCCTGGAAGCCACAGAGCAGG - Intronic
1179862278 21:44196524-44196546 CCACCAGGAAGCCACAGACAAGG - Intergenic
1180698751 22:17770402-17770424 CTCCCCCAAAACCAAAGAGAAGG - Intronic
1180833752 22:18919582-18919604 CTCTCAGAAAGCCACAGAGATGG - Exonic
1181066080 22:20306672-20306694 CTCTCAGAAAGCCACAGAGATGG + Intergenic
1183003453 22:34880535-34880557 CTCCTAAGCAGTCACAGAGATGG + Intergenic
1183478969 22:38052551-38052573 CTCAGACGGAGCCACAGGGATGG + Intergenic
1185137033 22:49079068-49079090 TTCCCAGGAAGCCACAGGAAAGG + Intergenic
1203283838 22_KI270734v1_random:144880-144902 CTCTCAGAAAGCCACAGAGATGG - Intergenic
950703331 3:14765542-14765564 TTCCCACCAAGCAACAGTGAGGG - Intronic
951866569 3:27315286-27315308 CTCCCATGAAGCCAGTGAGTGGG + Intronic
953479333 3:43236579-43236601 TCTCCACAAAGCCACAGAGAAGG - Intergenic
953886304 3:46716098-46716120 CTCTCACTGAGCCACAGAAAGGG - Intronic
954419346 3:50410444-50410466 CTTCCCCGAACCCACAGAGCTGG + Intronic
954749878 3:52807426-52807448 CTCCCACTGAGGCTCAGAGAAGG + Intronic
958163570 3:89849827-89849849 CTCCCCAGAAGCCAAACAGATGG + Intergenic
960963878 3:123091155-123091177 CTCCCAGGAAACCACAGCCAGGG - Intronic
961596897 3:128025004-128025026 AACCCACAAAGCCAAAGAGAAGG + Intergenic
963926940 3:150960850-150960872 CACCCACGCAGTCACAGACAGGG + Intronic
964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG + Intergenic
965546989 3:169926401-169926423 CCCCCACAAAGCCACTGGGAAGG - Intronic
966480581 3:180404080-180404102 CACCCACCAAGCCACAAAGTTGG + Intergenic
967968262 3:194980000-194980022 CTCACAGAAAGCCACAGAAAAGG + Intergenic
968664531 4:1813849-1813871 CTCTCCAGAGGCCACAGAGATGG + Exonic
970415331 4:15851114-15851136 GTCCCAGGGAGCCACAGAGGTGG + Exonic
973816799 4:54626716-54626738 CACGCACCAAGCAACAGAGATGG + Intergenic
974813235 4:66972712-66972734 TTCCCACCAAGGCACAGTGATGG - Intergenic
974915551 4:68173941-68173963 ACCCCACAAAGCCACAGAGATGG + Intergenic
976047680 4:80970919-80970941 CACCAAGGAAGACACAGAGATGG - Intergenic
981127625 4:141124438-141124460 CTCCCAGAAATCCACAGAGCTGG - Intronic
983738115 4:171089432-171089454 CTCCCAGGTAGCCAGAGAGGAGG + Intergenic
987285499 5:16452164-16452186 CTCACAAGCAGCCACAGTGAAGG + Intronic
987845181 5:23274733-23274755 CTCCCAAGAAGCAAGAAAGATGG + Intergenic
992997658 5:82348500-82348522 CTAAAACCAAGCCACAGAGAGGG - Intronic
993497577 5:88624937-88624959 CTCCCACAAAGACACCCAGAAGG + Intergenic
995391035 5:111640343-111640365 ATCCTGCAAAGCCACAGAGATGG + Intergenic
997461439 5:134055187-134055209 CCCCCAGGAAGCCACAGGGGTGG + Intergenic
997613295 5:135230008-135230030 CTTCCACGAAGCCACAGAATGGG - Intronic
999246680 5:150158773-150158795 CGCCCAGGAAGACACAGTGATGG - Intergenic
999293629 5:150444157-150444179 CTCCCAAGAAGCCAAATAGGAGG + Exonic
999553225 5:152713135-152713157 CACCCACAAAGAGACAGAGAGGG + Intergenic
1002781068 6:366530-366552 ATCCCATGAAGCCGCAGAAACGG + Intergenic
1006104327 6:31707470-31707492 CTCCCCCAAGGCCACATAGATGG - Exonic
1006155872 6:32012461-32012483 CTCCCACGCAGCCCCAGAAGAGG - Intergenic
1006162205 6:32045315-32045337 CTCCCACGCAGCCCCAGAAGAGG - Exonic
1007890965 6:45291214-45291236 CTCCCAGGAAGCCACATCCATGG + Intronic
1008156570 6:48022284-48022306 CTACCTCAAAGCCACAGTGAGGG + Intronic
1010763845 6:79755942-79755964 TTCCCACCAAGCAGCAGAGAAGG - Intergenic
1015896941 6:138026629-138026651 CTCCCTCCAAGACAAAGAGAAGG + Intergenic
1016849207 6:148600116-148600138 CTCCTACCCATCCACAGAGAGGG + Intergenic
1016863414 6:148744227-148744249 CTCCAAAGAAGCCAAACAGAAGG + Intergenic
1017510418 6:155109755-155109777 CTTGTCCGAAGCCACAGAGATGG + Intronic
1018165114 6:161086418-161086440 CTTCCATGAAGCCAGAGAAAGGG + Exonic
1018434059 6:163745189-163745211 CCACCATGAAGCCACAGGGATGG - Intergenic
1019800354 7:3084004-3084026 CACCCTAGAAGACACAGAGATGG + Intergenic
1019997588 7:4734609-4734631 CCCCCATGAAGCCCCAGGGAGGG - Intronic
1022241258 7:28514869-28514891 CTCCCTTGAAGCTACAGAGTAGG + Intronic
1022633684 7:32110614-32110636 CTCTGATTAAGCCACAGAGATGG + Intronic
1024653324 7:51427343-51427365 CTCTCACGAGGGCCCAGAGAAGG - Intergenic
1025855169 7:65269848-65269870 CTCCCACGCACCCACCGAGTCGG - Intergenic
1029195305 7:98801712-98801734 CCCCCTCCAGGCCACAGAGAAGG + Intergenic
1029862028 7:103582980-103583002 CTTCCACGGAGCCAGAAAGATGG + Intronic
1030497922 7:110323010-110323032 CTCCCACAAAGTAACTGAGATGG + Intergenic
1030810639 7:113968443-113968465 CTCCCAAGAAACCACAGATGGGG - Intronic
1033658273 7:143387603-143387625 CTCCCCAGCAGCCTCAGAGAAGG - Intronic
1037926155 8:22845642-22845664 CCCCCAGCAGGCCACAGAGATGG - Intronic
1039549207 8:38430773-38430795 CTCCCACCCAGGGACAGAGAAGG - Intronic
1039791438 8:40879009-40879031 CTTCCAGGAAGCCACAGACAGGG - Intronic
1041033585 8:53763782-53763804 CTCCCTGGAAGCTAGAGAGATGG + Intronic
1047902876 8:129442919-129442941 CTCCCAAAAAGCAAAAGAGATGG + Intergenic
1048255221 8:132900514-132900536 CTCCCAAGAAACTGCAGAGATGG - Intronic
1052062192 9:23974162-23974184 CCCACAAGAAGCCACAGAGCAGG - Intergenic
1052996319 9:34553267-34553289 CCACCAGGAAGCCACAGAGAGGG + Intronic
1053533264 9:38902226-38902248 CACCCATGTAGCCACAGAGCTGG + Intergenic
1054205490 9:62126655-62126677 CACCCATGTAGCCACAGAGCTGG + Intergenic
1054632871 9:67461715-67461737 CACCCATGTAGCCACAGAGCTGG - Intergenic
1056667393 9:88591594-88591616 TTGCCAGGAAGCCACAGAGTCGG - Intergenic
1057150961 9:92795660-92795682 CACCCATGTAGCCACAGAGCTGG - Intergenic
1057332557 9:94129286-94129308 CGCCCACAAAGCCACACAGGTGG + Intergenic
1057810856 9:98255669-98255691 CCCCCAGGAAGCCACAGAGTCGG + Intronic
1058317513 9:103586839-103586861 CAACCCCGAAGCCACAGAGGGGG - Intergenic
1060186094 9:121565028-121565050 CTCCCAGGCAGCCATTGAGAAGG + Intergenic
1060419610 9:123458478-123458500 ATCCCGCAAAGTCACAGAGAGGG + Intronic
1060484188 9:124036859-124036881 CTCCCAGGGGGCCACAGTGATGG + Intergenic
1062165483 9:135105395-135105417 CTCCCACCAACCCACAGAATCGG + Intronic
1062431089 9:136527178-136527200 CTCCCACATGGCCACAGAGCTGG + Intronic
1062736321 9:138139553-138139575 TTCCCAGGAAGCCCCAGAGTTGG - Intergenic
1186224198 X:7379946-7379968 CTTCCACAAAGCTACAGACAAGG + Intergenic
1187129695 X:16490507-16490529 CTACCAAGAACTCACAGAGATGG - Intergenic
1196203921 X:112917462-112917484 CTCCCACGTAGCCACTGTTAAGG - Intergenic
1200398557 X:156005658-156005680 TTCCCAGGAAGCCCCAGAGTTGG - Intronic
1201968317 Y:19762843-19762865 CCCCCACAAATGCACAGAGAGGG - Intergenic