ID: 1148865097

View in Genome Browser
Species Human (GRCh38)
Location 17:50624213-50624235
Sequence GGAATGGCTTTGAGTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 1, 2: 1, 3: 37, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148865081_1148865097 19 Left 1148865081 17:50624171-50624193 CCAAAGAGGTATCTCTGACCTCA 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1148865097 17:50624213-50624235 GGAATGGCTTTGAGTCCAGGGGG 0: 1
1: 1
2: 1
3: 37
4: 280
1148865085_1148865097 1 Left 1148865085 17:50624189-50624211 CCTCAGGGGAGCCTCCAGCCTGG 0: 1
1: 0
2: 8
3: 213
4: 4517
Right 1148865097 17:50624213-50624235 GGAATGGCTTTGAGTCCAGGGGG 0: 1
1: 1
2: 1
3: 37
4: 280
1148865091_1148865097 -10 Left 1148865091 17:50624200-50624222 CCTCCAGCCTGGGGGAATGGCTT 0: 1
1: 0
2: 3
3: 18
4: 232
Right 1148865097 17:50624213-50624235 GGAATGGCTTTGAGTCCAGGGGG 0: 1
1: 1
2: 1
3: 37
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148865097 Original CRISPR GGAATGGCTTTGAGTCCAGG GGG Intronic
900677630 1:3898381-3898403 GGAATGGCTGGGATTACAGGAGG - Intronic
900965625 1:5956313-5956335 GGAATGGCTTTTGCTCCTGGGGG - Intronic
901305682 1:8231150-8231172 GGCATGGCTCTGAGACCTGGTGG + Intergenic
901732378 1:11289650-11289672 AGAATGGCTTTGAATCCGGGAGG - Intronic
902179901 1:14679952-14679974 GGAAAGGCTTTGAGACCAACAGG + Intronic
902326158 1:15702112-15702134 GGAATGTCTGTGAGACCAGAGGG + Intronic
903754778 1:25653165-25653187 AGGATGGATTTGAGCCCAGGAGG - Intronic
903813648 1:26048783-26048805 TGAAGGGATTTGAGTCCAGAAGG - Intergenic
903864362 1:26387600-26387622 AGGATCGATTTGAGTCCAGGAGG - Intergenic
903906706 1:26693097-26693119 GGACTGGATTTGAGGCCTGGAGG - Intergenic
904895394 1:33813658-33813680 GAACTGGCTGTGGGTCCAGGTGG - Intronic
905089023 1:35411970-35411992 AGAATGGCGTTGAACCCAGGAGG - Intronic
905317851 1:37094961-37094983 GGAATGGCTGAGGGTCCTGGGGG - Intergenic
906121451 1:43394787-43394809 AGAATTGCTTTAAATCCAGGAGG + Intronic
906666339 1:47624712-47624734 GCAGAGGCTGTGAGTCCAGGAGG - Intergenic
907813864 1:57899315-57899337 GGAATTGCTTTGGATCCTGGAGG + Intronic
908012358 1:59791406-59791428 GTTTTGGCTTTGGGTCCAGGTGG - Intergenic
908282862 1:62560554-62560576 TGAATGCCATAGAGTCCAGGTGG - Intronic
909406548 1:75296733-75296755 GCATTGGTTTTGAGACCAGGTGG - Intronic
912321443 1:108717344-108717366 GGGATGGCTGTGGGACCAGGAGG + Intronic
914256400 1:145963519-145963541 GGAATGAGTTTGTGTCCAGCTGG + Exonic
915488586 1:156239116-156239138 GGCATGGCTTTAAGAGCAGGGGG - Intronic
916260630 1:162838793-162838815 GGTATGGCTACCAGTCCAGGTGG - Intronic
917106885 1:171501216-171501238 AGGACTGCTTTGAGTCCAGGAGG - Intronic
918844465 1:189591757-189591779 AGAATCGCTTTGAATCCAGGAGG + Intergenic
920747010 1:208638387-208638409 GGACTGGGTTGGAATCCAGGTGG - Intergenic
920947045 1:210539432-210539454 GGAAGGCCTTTGAGCCCAGGTGG + Intronic
921689213 1:218128691-218128713 GGAAAGGCATTGAGACCAGGAGG + Intergenic
924606897 1:245542900-245542922 GAACTGGCTTAGAGTACAGGAGG - Intronic
1062834949 10:629380-629402 GGAGTGTCTGTGTGTCCAGGGGG - Intronic
1065858731 10:29852271-29852293 GCCATGGCTATGAGTGCAGGTGG + Intergenic
1067566071 10:47338689-47338711 GGAGTGAACTTGAGTCCAGGAGG + Intergenic
1069383196 10:67861245-67861267 AGAATCGCTTTGAACCCAGGAGG + Intergenic
1069914446 10:71778843-71778865 GGATTGCTCTTGAGTCCAGGAGG - Intronic
1070904166 10:80057044-80057066 AATATAGCTTTGAGTCCAGGAGG + Intergenic
1071337459 10:84612431-84612453 GGAAGGGCTGTGTGTCCCGGGGG + Intergenic
1073126509 10:101153829-101153851 AGAATCGCTTAGAATCCAGGAGG - Intergenic
1073328490 10:102656315-102656337 GGAAGAGCTTGGAGTTCAGGTGG - Exonic
1076321057 10:129581806-129581828 GAAATGGTTTTGTCTCCAGGAGG - Intronic
1078348156 11:10569940-10569962 GGCAAGGCTTTGTGTCAAGGAGG + Intronic
1079897413 11:26138776-26138798 GTATTGGCTTTGGGACCAGGTGG - Intergenic
1081718401 11:45267830-45267852 GGCTTGGCTTCCAGTCCAGGCGG + Intronic
1081915776 11:46729310-46729332 GAAATGGCGTTGGGGCCAGGCGG + Intronic
1082270052 11:50160675-50160697 GGCATGGCTTTGAAACAAGGTGG - Intergenic
1083026177 11:59552965-59552987 GGAAAGGCTTTTAGTGGAGGAGG - Intergenic
1084043235 11:66554797-66554819 GGAATGGAATTGAATCCAGGAGG + Intronic
1084203180 11:67575975-67575997 AGAATCGCTTTGAACCCAGGAGG + Intergenic
1084691893 11:70732427-70732449 AGGATGGCTTTGGGGCCAGGTGG - Intronic
1084964361 11:72736727-72736749 GGAAAGGCTTTGAGTGGGGGTGG - Intronic
1085647068 11:78231436-78231458 AGAATCGCTTTGAACCCAGGAGG - Intronic
1087039702 11:93786554-93786576 AGAATCGTTTTGAATCCAGGAGG - Intronic
1087269857 11:96100127-96100149 GGAAGGGCATGGAGTCCAGATGG - Intronic
1088590484 11:111398732-111398754 GGAATGGCTGTCAGGCCTGGTGG + Intronic
1089292409 11:117445307-117445329 GGTCTGGCCTTGAATCCAGGAGG + Intronic
1090064467 11:123491377-123491399 GGAATGTCCGTGAGTCCATGGGG - Intergenic
1090716875 11:129438885-129438907 AGAAGAGCTTTGATTCCAGGAGG + Intronic
1092701803 12:11240170-11240192 TGAATGGCATTGAGTCCCTGTGG - Intergenic
1096501204 12:52064715-52064737 GGAAGGGGGTTGATTCCAGGAGG - Intergenic
1097982505 12:65748846-65748868 AGAATTGCTTTGAACCCAGGAGG + Intergenic
1100533140 12:95478980-95479002 GGAGGATCTTTGAGTCCAGGGGG + Intronic
1101038747 12:100732782-100732804 GGAAAGGCTGAGAATCCAGGTGG - Intronic
1101964068 12:109270125-109270147 GGAAAGGCATTAAGCCCAGGGGG - Intergenic
1103737820 12:123071477-123071499 GGAGTGGCTCTGGGTTCAGGTGG + Intronic
1103739128 12:123079436-123079458 AGAATTGTTTTGAGCCCAGGAGG - Intronic
1104121250 12:125802426-125802448 AGAATGGCTGTGAACCCAGGAGG - Intergenic
1104481684 12:129113312-129113334 TGATTGGCTTTCTGTCCAGGGGG + Intronic
1104926193 12:132315117-132315139 GGCCGGGCTCTGAGTCCAGGCGG + Intronic
1105388120 13:19950947-19950969 AGAATGGCTTTGAATGCATGTGG + Intergenic
1105473927 13:20715038-20715060 GGAATGGTTTTGAGACCACAGGG - Intronic
1106002153 13:25734268-25734290 GGAAAGGCTCTGTGTCCAGCTGG + Intronic
1107040596 13:35943661-35943683 GTACTGGCTTTGAGGCCAGCAGG + Intronic
1110935449 13:81281783-81281805 AGAATGGCTTAAACTCCAGGTGG - Intergenic
1112122661 13:96430627-96430649 GGAATGGCTGGAAGTCCAGGTGG - Intronic
1113561317 13:111283648-111283670 GGAAAGGCGCTGAGCCCAGGTGG + Intronic
1115747111 14:36449318-36449340 AGGATTGCTTTGAGCCCAGGGGG - Intergenic
1118527323 14:66661126-66661148 GGAAGGGATCTGAATCCAGGGGG + Intronic
1118810027 14:69266546-69266568 GGAATAGAATTGAGGCCAGGAGG + Intronic
1119868222 14:77991797-77991819 GATGTGGGTTTGAGTCCAGGAGG - Intergenic
1120047222 14:79821055-79821077 GGAAAGGCTTTGAGGGCAGGAGG + Intronic
1122834049 14:104422445-104422467 GGAAGGGCTTCGCTTCCAGGAGG + Intergenic
1122930598 14:104931563-104931585 GGACTGGCTCTGAGGCCTGGCGG - Intronic
1124054364 15:26228249-26228271 GGAATGGCTCTCAGTGCAGAGGG + Intergenic
1126095991 15:45091123-45091145 GGAAGGGCTTTGGGGCCAGGGGG - Intergenic
1126665888 15:51076334-51076356 GGAACCACTCTGAGTCCAGGGGG + Intronic
1126671539 15:51119866-51119888 GGAATAGCTGTGACTCCAGGAGG - Intergenic
1128707872 15:69850814-69850836 GGAAGGGCTTTGAATTCAAGAGG - Intergenic
1128929752 15:71693555-71693577 AGGATGGCTTTGAGCCCAGGAGG + Intronic
1129117768 15:73374829-73374851 GGCCTGGCTCTGAGTCCAGGTGG - Intergenic
1130528093 15:84724365-84724387 AGAATTGCTTAGAATCCAGGGGG - Intergenic
1130955499 15:88624354-88624376 GAAAGGGCAGTGAGTCCAGGCGG + Intronic
1131849143 15:96519148-96519170 GCATTGGCTTTGATTGCAGGTGG - Intergenic
1132121152 15:99176521-99176543 TGAATTGCTTTGAGCCCGGGAGG + Intronic
1132503490 16:295457-295479 CGGATAGCTTTGAGTCCAGGAGG + Intronic
1133418972 16:5629461-5629483 GCAGTGGCTTTGGGTCCATGAGG - Intergenic
1134816574 16:17210766-17210788 CGAATGGCATTGAGTCAGGGGGG + Intronic
1135066505 16:19314768-19314790 GGAAAGGCTGTGAGTCCTGCGGG - Intronic
1135103662 16:19628273-19628295 AGAATTGCTTGGAGCCCAGGAGG + Intronic
1135735689 16:24930400-24930422 ATAATGGCTTTTATTCCAGGTGG - Intronic
1138462717 16:57161599-57161621 AGAATGGCATTGAACCCAGGAGG - Intronic
1138535083 16:57655617-57655639 GGAAAGGCTTTGACTCCCAGAGG - Intronic
1140652176 16:77099976-77099998 GAAAAGTCTTTGAGTGCAGGAGG + Intergenic
1141216944 16:82033642-82033664 GAGTTGGCTTTGAGCCCAGGTGG + Intergenic
1141253531 16:82380399-82380421 GGGCTGGCTTTGAATCCAGGTGG - Intergenic
1141583836 16:85019626-85019648 AGAATGGCTCTGTGCCCAGGAGG + Intergenic
1142730690 17:1854474-1854496 AGAACTGCTTTGAGTGCAGGAGG + Intronic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143815346 17:9507861-9507883 GCATTGGCTTTGGTTCCAGGTGG - Intronic
1144322398 17:14141438-14141460 AGGATGGCATAGAGTCCAGGAGG + Intronic
1146180272 17:30693757-30693779 GGAATGGCTCTCCCTCCAGGAGG + Intergenic
1146696648 17:34913668-34913690 CGAATTGCTTTGAACCCAGGAGG + Intergenic
1148346667 17:46908055-46908077 GGAATGTGCTTGATTCCAGGAGG + Intergenic
1148540550 17:48477127-48477149 AGACTGGCTCTTAGTCCAGGAGG - Intergenic
1148865097 17:50624213-50624235 GGAATGGCTTTGAGTCCAGGGGG + Intronic
1148886945 17:50780831-50780853 AGAATCGCTTTGAACCCAGGAGG - Intergenic
1149135813 17:53362238-53362260 TGAAAGGCTTTGAGTCTTGGAGG - Intergenic
1149835069 17:59905104-59905126 AGGATTGCTTTGAGTCCAAGAGG - Intronic
1150133343 17:62680807-62680829 GGAATGGCTGCGCTTCCAGGAGG + Exonic
1151739133 17:75967378-75967400 AGAATGGCTTTGAACCCAGGAGG + Intronic
1152078828 17:78174254-78174276 GGAAGGGCTTTGAGCCCAAAAGG + Exonic
1152680059 17:81662908-81662930 AGAATGGCTTTGAACCCAGGAGG + Intronic
1153583188 18:6596092-6596114 TGGATGGCTCTGAGTCCATGAGG - Intergenic
1153669320 18:7395104-7395126 GGAACTGCATTTAGTCCAGGCGG + Intergenic
1154235381 18:12600810-12600832 GGAACACTTTTGAGTCCAGGAGG - Intronic
1155505557 18:26529268-26529290 GGAAGGGTTTTGAGTGGAGGGGG - Intronic
1156894451 18:42229524-42229546 GGAATTTCTTTCAGTCCTGGAGG + Intergenic
1157941806 18:51936829-51936851 GGAATGGCTTTGAGGTTAAGAGG - Intergenic
1158434831 18:57428367-57428389 GGAATGGCGCCGGGTCCAGGCGG - Intergenic
1158528499 18:58236527-58236549 GGAACGGCTGTGAGGCCAGGAGG - Intronic
1158718454 18:59900644-59900666 GGAAGCGCTGGGAGTCCAGGCGG - Intronic
1160526925 18:79543836-79543858 GGAATAGCTCTGAGTCCTGAGGG + Intergenic
1160923263 19:1530384-1530406 AGAATCGCTTTGAACCCAGGAGG - Intronic
1161203352 19:3028258-3028280 GGCAGGGCTTTGAGTCACGGTGG - Intronic
1161335599 19:3711285-3711307 AGAATCGCTTTGAACCCAGGAGG - Intronic
1162882050 19:13667010-13667032 GGACTGGCCCTGACTCCAGGAGG + Intergenic
1162978328 19:14221783-14221805 GGAATGGCTCTCCCTCCAGGAGG - Intergenic
1163085330 19:14975661-14975683 AGAATCGCTTTGAACCCAGGAGG + Intronic
1163677600 19:18663103-18663125 GGAAAGCCTTTGAGTCCCTGGGG - Intronic
1164504942 19:28852102-28852124 TGGCTGGCTTTGAGACCAGGTGG - Intergenic
1164556696 19:29258592-29258614 GGAATGGGTGAGAGTCCAGGTGG - Intergenic
1165098864 19:33426584-33426606 AGAGTGGCTGTGAGTCCATGTGG - Intronic
1165322691 19:35096059-35096081 GGGAGGGCTCTGAGCCCAGGAGG + Intergenic
1165403338 19:35615500-35615522 GGAATGTCCATGAGGCCAGGAGG + Intronic
1165695986 19:37901339-37901361 AGAATTGCTTTGAACCCAGGAGG + Intronic
1165767879 19:38362110-38362132 GGGCTGGCTTTGAGGCTAGGAGG + Intronic
1165818763 19:38660870-38660892 GGAATGGCTTTGCGAGCGGGTGG + Intronic
1167150673 19:47707539-47707561 GCAACTGCTGTGAGTCCAGGTGG + Intergenic
1167479684 19:49722273-49722295 GGCATGGCTTTGATTGCAAGTGG - Intergenic
1167688000 19:50968585-50968607 GGAACAGCTTTGAGACGAGGAGG + Exonic
1168081918 19:54016333-54016355 GGAATGGCTCTTTGTCCAGTGGG + Intergenic
925057289 2:864985-865007 GGAGGGGCTGTGAGTCCAGCAGG + Intergenic
925404254 2:3595682-3595704 GGAAAGACTTTGAGTTCAGATGG + Intronic
926401797 2:12504653-12504675 GAAATGACTTTGTGGCCAGGAGG - Intergenic
927468121 2:23351877-23351899 GGAATTGCTTTGAGGCCGGAGGG - Intergenic
929145506 2:38703924-38703946 AGAATTGCTTTGAACCCAGGAGG + Intronic
931907860 2:66862285-66862307 AGAATGGCGTTGAACCCAGGAGG - Intergenic
931949242 2:67343109-67343131 GTAATGTCTTAGAGTCCAGCAGG - Intergenic
932618238 2:73249736-73249758 GAATTGGCTTTGAGACGAGGTGG + Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
934068146 2:88359085-88359107 AGGATCGCTTTGAGGCCAGGTGG + Intergenic
934473555 2:94577471-94577493 AGAATGGCAGTGAGTCCACGGGG + Intergenic
935074787 2:99730601-99730623 AGAATCGCTTTGAACCCAGGAGG - Intronic
936809193 2:116375753-116375775 TGAATGGATGTGAGTGCAGGAGG - Intergenic
937151552 2:119689919-119689941 AGGGTGGCTCTGAGTCCAGGTGG - Intergenic
937604374 2:123779764-123779786 GCACTGGCTTTGGGACCAGGAGG - Intergenic
937930949 2:127204926-127204948 GGCAAGGCTTTGAGTGCAGGTGG - Intronic
938823678 2:134983449-134983471 GGTCTGGCTCTGGGTCCAGGAGG - Intronic
938830862 2:135049194-135049216 AGAATTGCTTTGAACCCAGGAGG + Intergenic
941929601 2:170926769-170926791 GGGATGATTTTGAGCCCAGGAGG + Intergenic
942684366 2:178515551-178515573 GGAATGGCGGTGAGTTCAGGGGG + Exonic
943358394 2:186887981-186888003 GTAATGTCTTTGGGTCCAAGAGG - Intergenic
945842927 2:214909857-214909879 AGGATCACTTTGAGTCCAGGAGG + Intergenic
946211963 2:218154473-218154495 AGAATCGCTTTGAGCCCAAGAGG - Intergenic
946305984 2:218857356-218857378 GGAATGGGACTGAGTGCAGGAGG + Intergenic
1171368746 20:24646384-24646406 GGAAAGCCTTTGGGTCAAGGGGG + Intronic
1172320467 20:33992354-33992376 AGAATCGCTTTGAACCCAGGAGG + Intergenic
1175734608 20:61376562-61376584 GGAAGGGCTCTTACTCCAGGCGG + Intronic
1175925142 20:62467732-62467754 GGCATGGCTTTGAGTGTGGGGGG - Intronic
1178326248 21:31647555-31647577 AGAATGGGTTTGAATCCTGGAGG + Intergenic
1179167943 21:38949231-38949253 GGAGGGGCTTTGGGTCCAGCTGG - Intergenic
1179202968 21:39244151-39244173 AGAATGGCATTGAACCCAGGAGG - Intronic
1181237689 22:21457578-21457600 GGAATGGCTGCGAGGCCAGAGGG + Intergenic
1181290724 22:21791015-21791037 AGGATGGCCTTGAGCCCAGGAGG + Intronic
1183507823 22:38219207-38219229 GGAGTGGCTGTGGGTACAGGCGG - Intergenic
1183628387 22:39018496-39018518 GGAATGGCCCTGAGGCCAGGAGG - Exonic
1183630988 22:39032425-39032447 GGAATGGCCCTGAGGCCAGGAGG - Exonic
1183634498 22:39052804-39052826 GGAATGGCCCTGAGGCCAGGAGG - Exonic
1183666573 22:39249550-39249572 GGCAGGGCTTTGAACCCAGGTGG - Intergenic
949536995 3:5004008-5004030 AGAATCGCTTTGAACCCAGGAGG + Intergenic
949581591 3:5393865-5393887 GGAATCGCTTTGAACCCAGGAGG - Intergenic
953398564 3:42591840-42591862 GGCATAGCTTTGAGTGAAGGAGG - Intronic
953772287 3:45787129-45787151 AGTATGGGTTTGATTCCAGGTGG - Intronic
954358196 3:50100335-50100357 GGAGTGGCATTTAGTTCAGGCGG + Intronic
954453079 3:50582165-50582187 GGAATGGGCCTGAGGCCAGGAGG - Exonic
954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG + Intergenic
954643543 3:52116709-52116731 GGATTGGCTTTCAGTCAGGGAGG + Intronic
955080826 3:55656495-55656517 GGCCTGGCCTTGAGTCCGGGAGG + Intronic
955887941 3:63620429-63620451 GGAATCGCTTTGAGCCCAGGAGG - Intergenic
956974568 3:74565172-74565194 GCAATGCCTTAGTGTCCAGGAGG + Intergenic
959322876 3:104901222-104901244 GGAAGGGCTACGAATCCAGGGGG + Intergenic
960289945 3:115871878-115871900 GGAATATTTTTGAGTCCAGTTGG - Intronic
962368063 3:134798623-134798645 GGCCTGGCTTTGTGTCCAGAAGG - Intronic
963371860 3:144411671-144411693 GCATTGGCTTTGCTTCCAGGTGG + Intergenic
963640588 3:147857563-147857585 GGAAAGGGTTTGAGTCATGGGGG - Intergenic
964738830 3:159944279-159944301 AGAATTGCTTTGAACCCAGGAGG - Intergenic
965009078 3:163062947-163062969 GGAAAGGAACTGAGTCCAGGGGG + Intergenic
966081294 3:176004989-176005011 TGAAGGGCATGGAGTCCAGGTGG + Intergenic
966101046 3:176269364-176269386 GGATGGGCTTTGAGGCCGGGGGG + Intergenic
966184313 3:177214453-177214475 GAAATGGCTTGAAGGCCAGGAGG + Intergenic
966369350 3:179231729-179231751 AGAATTGCTTTGAACCCAGGAGG - Intronic
967620667 3:191629741-191629763 AGAATCGGTTTGAATCCAGGAGG + Intergenic
968247464 3:197166800-197166822 AGAATCGCTTTGAACCCAGGAGG + Intronic
968569278 4:1331138-1331160 GGCGTGGGTCTGAGTCCAGGAGG - Intronic
969212660 4:5699731-5699753 GGAATTACTTGGAGCCCAGGAGG + Intronic
973734483 4:53856930-53856952 GGTCTGGCTTTGGGTCCAGGAGG + Intronic
975917941 4:79347293-79347315 GAAATGCCTGTGTGTCCAGGGGG + Intergenic
977427313 4:96883864-96883886 AGCAAGGCTTTGAATCCAGGGGG + Intergenic
977825465 4:101526186-101526208 GCATTGGCTTTAAGACCAGGTGG + Intronic
979225877 4:118283838-118283860 GGAATAGCTTTGACTCAAGCAGG - Intronic
981178205 4:141707596-141707618 TGAATGGCTTTGATTCTGGGTGG + Intronic
981422569 4:144567871-144567893 GGAATGTCTGTGAGTCCATTAGG - Intergenic
985733308 5:1563629-1563651 GGCATGGCCTTGAATCCATGTGG - Intergenic
985813601 5:2110360-2110382 GGAAAGGCTTTGAAAACAGGAGG + Intergenic
986003635 5:3649657-3649679 GGACTGGCTTTGCCTCCATGAGG - Intergenic
987110782 5:14684552-14684574 GGAAGGGCTGTGGGGCCAGGGGG - Intronic
987158216 5:15112840-15112862 GGAATGTCCTTGAGTCCAAGTGG + Intergenic
990257071 5:53981808-53981830 AGAATTGCTTTGAATCCAGCAGG + Intronic
994075561 5:95646214-95646236 AGAATCGCTTTGAATCCAGGAGG - Intergenic
994587710 5:101730931-101730953 AGGATTGCTTTGAGCCCAGGAGG + Intergenic
994678828 5:102860353-102860375 TGCAGGGCTTTGAGCCCAGGTGG + Intronic
997931982 5:138080232-138080254 AGAATGGCTTTGAACCCAGGAGG + Intergenic
1002078855 5:176726091-176726113 GAAATTGCTTGGAGACCAGGCGG + Intergenic
1003488733 6:6602080-6602102 GGAAGTGCTTTGAGTCAAGAAGG - Intronic
1003937629 6:10992177-10992199 GAAATTGCTGTGAGTGCAGGGGG - Intronic
1004035206 6:11916952-11916974 GGAAAGGCTTTGAGTTCAAGAGG + Intergenic
1004461259 6:15838601-15838623 AGAATTGCTTTGAACCCAGGAGG + Intergenic
1005609911 6:27513753-27513775 AGAAAGGCTTAGAATCCAGGAGG + Intergenic
1006777706 6:36608852-36608874 AGGATTGCTTTGAGCCCAGGAGG + Intergenic
1007513539 6:42393239-42393261 GGAATGCCTTTCTGGCCAGGTGG - Intronic
1007826929 6:44607632-44607654 GGAGAGGCGTTGTGTCCAGGTGG + Intergenic
1008462919 6:51796900-51796922 GGAATCCATTTGAATCCAGGAGG - Intronic
1009686302 6:66962052-66962074 GGAATGCCAGTGAGTCCCGGAGG + Intergenic
1009990657 6:70839309-70839331 GCAATGACTTTGAGACAAGGTGG - Intronic
1010072779 6:71763530-71763552 GGAATGTGCTTGAGTCAAGGGGG - Intergenic
1011498940 6:87966732-87966754 GGTTTGGCTCTGAGTCCAAGTGG + Intergenic
1011643713 6:89437881-89437903 AGGATGGCTTTGAGCCCAGGAGG - Intronic
1012801288 6:103832542-103832564 GGCATGGCTTTGACTACAGCAGG - Intergenic
1013238542 6:108221633-108221655 AGGATCACTTTGAGTCCAGGAGG - Intronic
1013418770 6:109947665-109947687 GGAATGGCATGGAGGGCAGGGGG - Intergenic
1013444104 6:110204100-110204122 AGAATGGCGTTGAACCCAGGAGG - Intronic
1014216015 6:118753506-118753528 AGGATCGCTTTGAGCCCAGGAGG - Intergenic
1014339851 6:120190681-120190703 GGAAAGGACTTGAATCCAGGTGG + Intergenic
1015240696 6:131020480-131020502 GGAATCACTTTGGGTCAAGGAGG - Intronic
1017174688 6:151492303-151492325 AGGATAGCTTTGAGCCCAGGAGG - Intergenic
1018205909 6:161436740-161436762 GGAATGGCTCTTAATCCAGGTGG - Intronic
1018748589 6:166781786-166781808 GGCATGGTTTAGAGTCCAGAAGG + Intronic
1019098033 6:169602253-169602275 GGAATCGCTTTCAGTCCTTGTGG - Exonic
1020126161 7:5533497-5533519 GTGAAGGCTTTGAGCCCAGGAGG - Intronic
1020486020 7:8721686-8721708 GAGATGGCTGTGAGCCCAGGAGG + Intronic
1023087556 7:36586472-36586494 GGAAGGGCTTACAGTCCTGGAGG - Intronic
1023814682 7:43940608-43940630 GAAATGGCTGTGAGCCCATGAGG - Intronic
1024108406 7:46117817-46117839 AGGATGGGCTTGAGTCCAGGAGG - Intergenic
1024788991 7:52940963-52940985 AGAAGGGAGTTGAGTCCAGGAGG + Intergenic
1025135652 7:56409600-56409622 AGAATTGCTTTGAACCCAGGAGG + Intergenic
1026320054 7:69260447-69260469 GCAATGGCCTGGAGTCCTGGAGG + Intergenic
1026914140 7:74109754-74109776 AGAATGGCGTTGAACCCAGGGGG + Intronic
1027239786 7:76319478-76319500 AGGATTGCTTTGAGTCCAGCAGG + Intergenic
1028610599 7:92706308-92706330 AGGATGGCCTTGAGCCCAGGAGG + Intronic
1031403960 7:121360743-121360765 AGAACTGCTTTGAGGCCAGGAGG + Intronic
1033870393 7:145747273-145747295 AGAATCACTTTGAATCCAGGAGG + Intergenic
1034224012 7:149468925-149468947 GACATGGCTTGGAGTTCAGGAGG - Intergenic
1034417930 7:150974985-150975007 GGAAGGGCTGGGAGTCCCGGAGG - Intronic
1034893034 7:154857394-154857416 CGAATGGCTTTGAGTCCACCTGG + Intronic
1035535065 8:384641-384663 GTGCTGGATTTGAGTCCAGGTGG - Intergenic
1037657007 8:20893189-20893211 GGAGAGGTTTTGAGGCCAGGTGG + Intergenic
1038409735 8:27348860-27348882 GGAATGGCTTGGGATGCAGGGGG - Intronic
1038847120 8:31240484-31240506 AGAATCACTTTGAGCCCAGGAGG - Intergenic
1039486828 8:37916677-37916699 CGAATTGCTTTGAACCCAGGAGG - Intergenic
1039871480 8:41549462-41549484 AGAATCGCTTGGACTCCAGGAGG - Intergenic
1041628824 8:60061924-60061946 AGAATGGCTTTGAGTCCAGGTGG - Intergenic
1043524853 8:81085336-81085358 GGATTGGCTGTGAGTCAAGCTGG - Intronic
1044233606 8:89806398-89806420 TGAAGGGCTTTGTGTCCTGGGGG - Intergenic
1047626410 8:126660587-126660609 GGGATGGCATTATGTCCAGGAGG + Intergenic
1048077979 8:131094156-131094178 GGTATGGCTTGGAGTCTTGGAGG + Intergenic
1048249616 8:132851698-132851720 AGGATTGCTTTGAGCCCAGGTGG + Intergenic
1048830327 8:138470276-138470298 GGAAAGGCAATGAGACCAGGTGG + Intronic
1050159224 9:2699608-2699630 AAAATGGCTATGAATCCAGGAGG - Intergenic
1050545602 9:6706286-6706308 GGAATGACTTTGAATACAGTGGG + Intergenic
1051978230 9:22980661-22980683 AGAATGGCGTTGAGCCCAAGAGG + Intergenic
1053362064 9:37495463-37495485 GGAATGGATTTGAATCCCAGGGG - Intronic
1053484756 9:38443287-38443309 GGAATGACTTTGGGTCAGGGAGG + Intergenic
1053684777 9:40511031-40511053 AGAATGGCAGTGAGTCCACGGGG - Intergenic
1053934741 9:43139314-43139336 AGAATGGCAGTGAGTCCACGGGG - Intergenic
1054278950 9:63113925-63113947 AGAATGGCAGTGAGTCCACGGGG + Intergenic
1054297871 9:63346494-63346516 AGAATGGCAGTGAGTCCATGGGG - Intergenic
1054395886 9:64651012-64651034 AGAATGGCAGTGAGTCCACGGGG - Intergenic
1054430530 9:65156207-65156229 AGAATGGCAGTGAGTCCACGGGG - Intergenic
1054499850 9:65865314-65865336 AGAATGGCAGTGAGTCCACGGGG + Intergenic
1054925911 9:70588601-70588623 GGAAGGGCTGTGGGTCCAGGCGG + Intronic
1055419332 9:76121743-76121765 AAAATGGCTTTGAGGCCAGATGG - Intronic
1056510727 9:87302642-87302664 AGGACGGCTTTGAGTCCAGGAGG - Intergenic
1056965115 9:91159145-91159167 GGAATCGCTTTGAGCCTAGGAGG + Intergenic
1062116995 9:134814854-134814876 GGAGGGCCTTTGGGTCCAGGGGG - Exonic
1186078608 X:5906989-5907011 AGAATCGCTTTGAATCCAGAAGG + Intronic
1186192624 X:7081240-7081262 AGAATCGTTTTGAGCCCAGGAGG - Intronic
1188321193 X:28739201-28739223 GGAATGTCTTTCAGTGAAGGTGG - Intronic
1189203923 X:39221495-39221517 GGATTGGCATAGAGTACAGGTGG + Intergenic
1190560382 X:51680659-51680681 GGAATGGCTTTGAGTGGGGGTGG - Intergenic
1190563909 X:51712662-51712684 GGAATGGCTTTGAGTGGGGGTGG + Intergenic
1191184430 X:57593569-57593591 CGAAAGGCTTTGTGCCCAGGTGG - Exonic
1191212959 X:57908890-57908912 CGAAAGGCTTTGTGCCCAGGTGG + Exonic
1193409955 X:81150474-81150496 AGAATCGCTTTGAACCCAGGAGG + Intronic
1195628471 X:107029180-107029202 GGAAGGGCTTTAAATCCATGTGG - Intergenic
1198486547 X:137092998-137093020 GGAATAGCTCAGAGACCAGGAGG - Intergenic
1198548462 X:137719364-137719386 GGTTTGGCTTTGATTCCAGGTGG + Intergenic
1198955947 X:142130643-142130665 GGAGTGTCCTTGTGTCCAGGTGG - Intergenic
1200167779 X:154049240-154049262 GGAACAGGTTTGAGTCCAGTTGG + Intronic
1201050415 Y:9927223-9927245 GGACTGTCTTTTACTCCAGGAGG + Intergenic
1201682921 Y:16668581-16668603 AGAATGGCTTTAAGCCCAGAAGG - Intergenic
1202368808 Y:24183877-24183899 AGGATTGCTTTGAGCCCAGGAGG - Intergenic
1202501977 Y:25486240-25486262 AGGATTGCTTTGAGCCCAGGAGG + Intergenic