ID: 1148866345

View in Genome Browser
Species Human (GRCh38)
Location 17:50630743-50630765
Sequence CAATGAGGGCATCAGACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148866342_1148866345 5 Left 1148866342 17:50630715-50630737 CCGTGGAGTGGGGCTGGCAACAG No data
Right 1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG No data
1148866341_1148866345 6 Left 1148866341 17:50630714-50630736 CCCGTGGAGTGGGGCTGGCAACA No data
Right 1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG No data
1148866336_1148866345 18 Left 1148866336 17:50630702-50630724 CCAGCTGAGCAGCCCGTGGAGTG No data
Right 1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG No data
1148866334_1148866345 25 Left 1148866334 17:50630695-50630717 CCTTGGGCCAGCTGAGCAGCCCG No data
Right 1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG No data
1148866333_1148866345 26 Left 1148866333 17:50630694-50630716 CCCTTGGGCCAGCTGAGCAGCCC No data
Right 1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148866345 Original CRISPR CAATGAGGGCATCAGACACC AGG Intergenic
No off target data available for this crispr