ID: 1148868904

View in Genome Browser
Species Human (GRCh38)
Location 17:50643977-50643999
Sequence CAGGGGCACTGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 591}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148868899_1148868904 -7 Left 1148868899 17:50643961-50643983 CCATCTCGCAGGTGGGCAGGGGC 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG 0: 1
1: 0
2: 8
3: 60
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148868904 Original CRISPR CAGGGGCACTGGAGGGCAGA GGG Intronic
900183768 1:1323912-1323934 CTGGGGGACTGGGGGGCTGAGGG + Intronic
900307997 1:2020186-2020208 GGGGGGCACTGTAGGCCAGAGGG - Intronic
900490973 1:2949006-2949028 CAGGTGCCGGGGAGGGCAGACGG + Intergenic
900657071 1:3763647-3763669 CAGGGGCAGTGAGGGACAGAAGG - Intronic
901209488 1:7516396-7516418 GAGGGGCCGTGGAGGGCAGCTGG + Intronic
901216938 1:7560271-7560293 CAGGGGACCTGAAGGGCAGTGGG - Intronic
901322000 1:8345719-8345741 AAGGGGCACTGGGAGGCAGTGGG - Intergenic
901658683 1:10785504-10785526 GGGGGGCACTGGAGGGGCGAGGG - Intronic
901757457 1:11449920-11449942 AAGGGGGACTGAAGGGCACACGG + Intergenic
902136348 1:14309483-14309505 CAGGGGCCTTGGAGGCCACAGGG + Intergenic
902581852 1:17412898-17412920 CGGGGGTACAGGAGGGGAGAGGG - Intronic
902776084 1:18675929-18675951 CAGGGATGCTGGTGGGCAGATGG - Intronic
902864528 1:19269456-19269478 CAGGGACCCAGGAGGGCTGAAGG + Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902923164 1:19679269-19679291 CAGCGGCCCTGGTGGGCAGCGGG - Exonic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903560218 1:24221459-24221481 CATGAGCACAGGAGGGGAGATGG + Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904862168 1:33546569-33546591 CAGTGGCACAGGAGAGGAGATGG - Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905279156 1:36837809-36837831 CAGAAGCTCTGGATGGCAGATGG + Intronic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905482373 1:38270516-38270538 CAGGGGGACTGCCAGGCAGAGGG - Intergenic
905739994 1:40361708-40361730 CTGGGGCACTGGTGGCCACAGGG + Intronic
906640086 1:47436686-47436708 CTGGGGCACGGAAGGGGAGATGG - Exonic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
909812305 1:79945272-79945294 CATGGACACTGCAGGGAAGATGG + Intergenic
910040885 1:82850463-82850485 GAGGGGAGCTGGAGGGCAAATGG + Intergenic
910684319 1:89900915-89900937 CATGGCGACTGGAGGCCAGAGGG + Intronic
912551805 1:110489761-110489783 CAGAGGAACAGGAGGTCAGACGG - Intergenic
912639664 1:111332979-111333001 CAGGGGCACTGGACAGGACAAGG + Intergenic
912806459 1:112760372-112760394 CTAGGACACTGGCGGGCAGAGGG + Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
913248427 1:116890898-116890920 CAGGGGCTGGGGAGAGCAGAAGG - Intergenic
914195473 1:145446077-145446099 CATGGGGACTGGAGAGCTGAAGG - Intergenic
914822326 1:151114251-151114273 GAGGGTCACTGGAGGCCAGGAGG + Intronic
915296094 1:154922948-154922970 GAGGGTCACTGGAAAGCAGATGG - Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916262782 1:162859404-162859426 CAGAGGCACAGCAGGGCAGCAGG - Intronic
916453786 1:164949240-164949262 CAGGAGAACTGGTGGGCTGAGGG + Intergenic
916573988 1:166051089-166051111 CAGGGGCATGGAAGGGCTGAGGG - Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918764371 1:188459582-188459604 CAGGGACACTGGCTGACAGAGGG - Intergenic
919798993 1:201339578-201339600 CTGGGGCAGTGGAGTGCAGTGGG - Intergenic
919887857 1:201947838-201947860 TGGGGGGACTGAAGGGCAGAAGG + Intergenic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920847541 1:209606657-209606679 CAGGGACTCTGGAGGGCTCAGGG - Intronic
922579678 1:226687691-226687713 CAAGGCCACAGGAGGGCAGGAGG - Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923206148 1:231760813-231760835 CAAGGGCACTAGAGGGCCCAGGG + Intronic
923538578 1:234871622-234871644 CGTGGGCACTGGCGGGCAGTGGG - Intergenic
923978957 1:239298413-239298435 CAGGGGGACTGGAGTGGGGAGGG - Intergenic
924335698 1:242985164-242985186 AATGGGCTCTGGAGGGGAGACGG - Intergenic
1062763457 10:44925-44947 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1062946109 10:1463335-1463357 CAGGGACACAGGAGGGCGGGAGG - Intronic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1065012579 10:21432805-21432827 CAGAGGCCCTAGAAGGCAGAGGG + Intergenic
1065068915 10:22002823-22002845 CAGGGGGACAGGAAGGCAAAAGG + Intronic
1065177734 10:23095555-23095577 CAGGGGCAGAGACGGGCAGAGGG + Exonic
1065643180 10:27805644-27805666 CAGGCGCCCAGGAGGGCAGAAGG + Intergenic
1066103514 10:32137900-32137922 AAGGGGAAATGGAGGGCGGAAGG + Intergenic
1066367763 10:34793277-34793299 CAAGGGAGCTGGAGGGCAGTAGG + Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067190678 10:44065376-44065398 CAAGGGCACTGCAAGGCAGCAGG + Intergenic
1067452205 10:46388688-46388710 CAAGGGGAATGGGGGGCAGAGGG + Intronic
1067544438 10:47182947-47182969 CATTGGCACTGGATGGCTGAGGG + Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067585032 10:47471067-47471089 CAAGGGGAATGGGGGGCAGAGGG - Intronic
1067784158 10:49230266-49230288 CAGGGGCCCGGGAGGAAAGATGG + Intergenic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069571153 10:69495161-69495183 GAGGGGCTCTGGAGGGCAAAGGG + Intronic
1069721153 10:70550079-70550101 TAGAGGCACTGAAGAGCAGAGGG + Intronic
1069926115 10:71851780-71851802 CAGGGGCACGTGGGGGCAGGTGG + Intergenic
1069942259 10:71964082-71964104 CCCGGGGACTGGAGGGCCGAGGG + Intergenic
1070279395 10:75037794-75037816 CAGAGGCACTTGGGGACAGAGGG - Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070756107 10:78994193-78994215 GAGTGGCAGTGAAGGGCAGATGG + Intergenic
1072035030 10:91555351-91555373 GAGGGGAACTGGAGGGGAGCTGG + Intergenic
1072520209 10:96224289-96224311 AAGCAGCACTGGAGGGCACAGGG + Intronic
1072669582 10:97419548-97419570 AAGGGGCAGTGGAGGGTAAAAGG + Intronic
1072737507 10:97889106-97889128 CAGGGGCAGTGGAGGCGGGAGGG + Intronic
1073007868 10:100338620-100338642 CAGGGCCACTGGGTGGCAGCAGG + Intergenic
1073107342 10:101039682-101039704 CAGGGGCCTTGGTGGGCAGATGG + Exonic
1073111528 10:101065795-101065817 CAGCCCCAATGGAGGGCAGACGG - Intronic
1073426482 10:103458347-103458369 CACGGGCACGGCAGTGCAGAAGG + Exonic
1074156522 10:110804924-110804946 CAGGTGCTTTTGAGGGCAGAGGG + Intronic
1074917327 10:117970102-117970124 GAGGGGCACAGGAGGTGAGAGGG + Intergenic
1075113767 10:119608925-119608947 CAGGAGCACTGAAGGGCAGCTGG + Intergenic
1075719547 10:124576706-124576728 CGGGGGTACTGGGGGGCTGAGGG + Intronic
1075863263 10:125696068-125696090 TGGGGCCACTGGAGGGTAGAGGG + Intergenic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076017905 10:127043658-127043680 CTGGGGCACAGACGGGCAGAGGG - Intronic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076886863 10:133267016-133267038 CTGGGGCCCTGCAGGACAGATGG - Intronic
1077101054 11:822584-822606 CAGGGGCTCCGGCGGGAAGAGGG - Exonic
1077114420 11:876924-876946 CAGGACCACTGGAGGGGAGCAGG - Intronic
1077186680 11:1238605-1238627 CAGGTGCATAGGTGGGCAGATGG + Intronic
1077506328 11:2931461-2931483 CGGGGGTACTGGAGGCCAGGAGG + Intergenic
1077555268 11:3222918-3222940 GAGGGACACTGGAGAGCAGGGGG + Intergenic
1078270352 11:9789053-9789075 CAGGGGCCCTGGAGGCATGAGGG - Intronic
1078441563 11:11372633-11372655 CAGGGGCAGGGGAGAGCAGAAGG + Intronic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1078602852 11:12748866-12748888 CAGGGGGACTGGGGGTCAAATGG + Intronic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080805673 11:35651063-35651085 CAGAGGCACTGCTGGGCACAGGG + Intergenic
1081617699 11:44600367-44600389 CATGGGCAGTGGTGGGCAGCAGG - Intronic
1081807809 11:45899872-45899894 CAGGGGAACGGGAGGGCGCAAGG + Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082794597 11:57370064-57370086 AAGGGGCATGGGAGGGAAGAGGG + Exonic
1083115814 11:60458232-60458254 TAGGTGCACAGGAGGCCAGAAGG + Intronic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083413822 11:62512471-62512493 CAGGGGCAAAGGAGGCCACAAGG - Intronic
1083611004 11:64004259-64004281 CTGGGGCAGTGGAGGGCACCAGG + Intronic
1083629217 11:64087229-64087251 CAGGGGCCCAGGAGAGCAGTGGG - Intronic
1083764855 11:64836812-64836834 CAGGGCCTCTGGAGGGGAGGTGG + Exonic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1084374203 11:68764717-68764739 CAGGGCCCCTGAAAGGCAGAAGG + Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084609289 11:70191907-70191929 CATGGAGACAGGAGGGCAGAGGG - Intergenic
1085906377 11:80769245-80769267 CAGGCCCACTTGAGGGTAGAAGG + Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087935192 11:104025689-104025711 CAAGGGCACTGGAAAGCGGAAGG + Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088598701 11:111457586-111457608 CAGGGGCACTGGAGTAGAGATGG - Intronic
1088737605 11:112740574-112740596 GAGCAGCACTGGAGGGCAAAGGG - Intergenic
1088932459 11:114366039-114366061 CACAGGCACTGGAGGGAACAAGG - Intergenic
1088994641 11:114985853-114985875 CAGGTGCCCAGGAGGGCAGGAGG + Intergenic
1089338730 11:117743496-117743518 TTGGGGAACTGGTGGGCAGATGG - Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089567415 11:119379014-119379036 CAGGGGCACTGGATGGGAGCTGG + Intronic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1090799039 11:130159548-130159570 CAGGGCCCCTGGAGGGCCGGAGG + Exonic
1090934662 11:131330695-131330717 AAGGGGCACAGAGGGGCAGAAGG + Intergenic
1091744360 12:2981774-2981796 CAGGGGTGCTGGAGGGTAGTGGG + Intronic
1091775414 12:3181755-3181777 AAGAGGCAGTGCAGGGCAGAGGG - Intronic
1092055311 12:5504049-5504071 CAGAGGCACTGGAATTCAGAGGG - Intronic
1092149280 12:6236086-6236108 CGGGAGAACTGGTGGGCAGAGGG - Intronic
1092229000 12:6766628-6766650 GAGGGGCCCTGGACGGCGGAGGG - Exonic
1092264516 12:6970559-6970581 CGGCGGCACTGGAGGTCAGAAGG + Exonic
1093870433 12:24284673-24284695 CAGGGTCACTGGACTGCAGCTGG - Intergenic
1096153408 12:49328944-49328966 CAGGGGCAGGGGAGGGCATCAGG - Exonic
1096464732 12:51842017-51842039 GAGGGGCACTGCTGGGCAGGTGG + Intergenic
1096657740 12:53102189-53102211 CAGGGCCACTGGAAGGAACATGG + Exonic
1096899739 12:54863941-54863963 CAGGGGCATTGGAGTTGAGAGGG - Intergenic
1100315091 12:93437828-93437850 CAGGGGAACTGGAATGCTGAAGG + Intronic
1101736203 12:107465198-107465220 TCGGGGCACTGGAGGGCAGACGG - Intronic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103505321 12:121439185-121439207 CAAGGGCCCTGGTGGGCAGGAGG - Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104041383 12:125133608-125133630 CAGGGGCAGTGGAGGGCACAGGG - Intronic
1105922891 13:24982157-24982179 CCTCGGCACTGGAGGACAGAAGG + Intergenic
1106144840 13:27041242-27041264 CAGGGAGACTGCAGGGCAGATGG - Intergenic
1106192773 13:27468526-27468548 CAGGGACACTGGAGGACCGGAGG - Intergenic
1106501879 13:30336684-30336706 TGGAGGCACTGGAGGGGAGAAGG - Intergenic
1106857843 13:33872228-33872250 CAAAGGCACTGGAGGGGAGAAGG + Intronic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1108052122 13:46455941-46455963 CAGGTACACAGGTGGGCAGAGGG + Intergenic
1108807809 13:54181420-54181442 CAGGGCTACTTGTGGGCAGAGGG - Intergenic
1109539164 13:63750253-63750275 CAGGTACACAGGTGGGCAGAGGG - Intergenic
1109544680 13:63829580-63829602 CAGGTACACAGGTGGGCAGAGGG + Intergenic
1110905558 13:80884032-80884054 CAGGACCACTTGAGGGCAGGTGG + Intergenic
1111450854 13:88413378-88413400 GAGGCCTACTGGAGGGCAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113859651 13:113472975-113472997 CAGAGGCACGGGGGGACAGAAGG - Intronic
1114490132 14:23095306-23095328 AAGGGGCGCTGCAGGGCGGATGG - Exonic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1116749380 14:48863884-48863906 GGGGACCACTGGAGGGCAGAGGG + Intergenic
1116810227 14:49532820-49532842 GAAGGGTAGTGGAGGGCAGAGGG + Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117293244 14:54353838-54353860 CATGGGCACACAAGGGCAGAGGG - Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1118320264 14:64748725-64748747 CAGGGGCTCTGGGGGGCTGAGGG - Exonic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1118573647 14:67219396-67219418 GAAGGTCACTGGAGGGCAGCTGG - Intronic
1119615246 14:76094689-76094711 CAAGGGCACTGCAGGGATGAAGG - Intergenic
1119669534 14:76508036-76508058 TAGGAGCATTGGAGGGGAGAGGG - Intergenic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1120682933 14:87502521-87502543 CTGGGGCATTGGTGGTCAGAAGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122030156 14:98906208-98906230 GAGGGGGACTGGATGGCAGGTGG - Intergenic
1122181535 14:99958607-99958629 CAGAGGCACAGGAGGTCAGAGGG + Intergenic
1122284022 14:100640222-100640244 AAGGGGCTCTGCAGGGCAGAGGG - Intergenic
1122516865 14:102314867-102314889 CAGGGGTGCAGGAGGGCAGAGGG + Intergenic
1122671897 14:103379080-103379102 CTGGGGTACTGGAAGCCAGAAGG + Intergenic
1122938810 14:104972112-104972134 CAGGGGCACTTGCCGGCAAATGG + Intronic
1123067654 14:105626622-105626644 AAAGGGCCTTGGAGGGCAGAGGG - Intergenic
1123071673 14:105645347-105645369 AAAGGGCCTTGGAGGGCAGAGGG - Intergenic
1123091337 14:105743623-105743645 AAAGGGCCTTGGAGGGCAGAGGG - Intergenic
1123097106 14:105771963-105771985 AAAGGGCCTTGGAGGGCAGAGGG - Intergenic
1124022833 15:25939617-25939639 CAGGGGCAGTGGGGGTTAGATGG + Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124071084 15:26393653-26393675 TAGGGGCACTGCAGGGAGGAGGG + Intergenic
1124345233 15:28917867-28917889 CAGGGGTACTGGGGGCCAGCTGG + Intronic
1125329186 15:38565210-38565232 GAGAGGCCCTGGAGGGGAGAAGG - Intronic
1125332758 15:38598215-38598237 CCTGGGCACTAGAGGCCAGAGGG - Intergenic
1126338187 15:47609866-47609888 CAGGGGCAGTGGCAGGCAGTGGG - Intronic
1127599258 15:60518784-60518806 CAGGGTCAGTGAAGGGGAGAGGG - Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128095210 15:64949078-64949100 GAGGGGCACGGAAGGTCAGAGGG + Intronic
1128243167 15:66115321-66115343 CCAGGGCACTGGGGGACAGATGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128668531 15:69556859-69556881 CGGGGGCAGCGGAAGGCAGAAGG - Intergenic
1129647086 15:77446145-77446167 CAGATGCACTGGAGAGCTGAAGG - Intronic
1129687095 15:77692756-77692778 CAGGGGCCCTGGAGGCGGGAGGG - Intronic
1129740332 15:77986793-77986815 CAGGGGCACCTCAGGGCTGAGGG - Intronic
1129845420 15:78765804-78765826 CAGGGGCACCTCAGGGCTGAGGG + Exonic
1129846576 15:78770576-78770598 CGGGGGTACTGGAGGGCTGGAGG + Intronic
1130014177 15:80174626-80174648 CAGGGCCCCTGGAAGGCAGAGGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130255340 15:82323378-82323400 CGGGGGTACTGGAGGGCCGGAGG - Intergenic
1130256428 15:82328055-82328077 CAGGGGCACCTCAGGGCTGAGGG - Intergenic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130598524 15:85261933-85261955 CAGGGGCACCTCAGGGCTGAGGG + Intergenic
1130599625 15:85266608-85266630 CGGGGGTACTGGAGGGCCGGAGG + Intergenic
1130760001 15:86809343-86809365 CAGGGGCTTTTGAGGGTAGAAGG - Intronic
1131024780 15:89130998-89131020 CAGAGGCACTGAAGGAGAGATGG - Intronic
1131250666 15:90828122-90828144 CCGGGACCCTGGAGGGCAGTTGG - Intergenic
1131619999 15:94058010-94058032 CAGGGGCAACGGTGGGCAGGAGG + Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132413054 15:101600083-101600105 CAGTGTCAATGGAGGCCAGAAGG - Intergenic
1132626480 16:894060-894082 CAGGGGGACGGGTGGGCGGATGG - Intronic
1132626494 16:894092-894114 CAGGGGCATGGGTGGGCGGACGG - Intronic
1132626517 16:894155-894177 CAGGGGGACGGGTGGGCGGACGG - Intronic
1132626551 16:894251-894273 CAGGGGGACAGGTGGGCGGACGG - Intronic
1132995209 16:2819138-2819160 CAGGGGCTGTGGGGGCCAGAAGG + Intronic
1133850665 16:9500373-9500395 GAGGAGCACTGGAGGCCAGTAGG - Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135414237 16:22256919-22256941 CAAGGGCTGTGGTGGGCAGAGGG - Intronic
1135989630 16:27210137-27210159 CAGGGGCTCTGCGGGGCAGTGGG - Exonic
1136120301 16:28128668-28128690 CAGGGGAAGTGCTGGGCAGAGGG - Intronic
1136121302 16:28136973-28136995 GAGGGAGACTGGAAGGCAGAAGG + Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137674034 16:50295000-50295022 CTGGGGCTCTGGAGCTCAGATGG + Intronic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1137837430 16:51606282-51606304 CAGGAGCTCTGGAGTGCAAATGG - Intergenic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1138561047 16:57801393-57801415 CAGGGGCACCAGGGAGCAGAGGG - Intronic
1139053834 16:63157463-63157485 CAGAGGCCTAGGAGGGCAGATGG + Intergenic
1139261166 16:65595676-65595698 CAGGGCCAAAGGAGAGCAGAGGG - Intergenic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139955523 16:70691302-70691324 CAGGGAGACTGGAGGTCACAGGG + Intronic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141170139 16:81685852-81685874 CAAGGACACTGGTGGGCACATGG - Intronic
1141480716 16:84304863-84304885 CTGGGCCACAGGAGGGCAGAGGG + Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142283815 16:89162896-89162918 CAGAGGCTCAGGAGGCCAGAGGG - Intergenic
1142338676 16:89507064-89507086 CCGGCCCACTGGAGGGCTGAGGG + Intronic
1142376284 16:89708646-89708668 CAGAGGCACCGGAAGGCAGCTGG + Intronic
1142525763 17:539607-539629 GAGGGTCACTGGAGCCCAGAAGG + Intronic
1142765846 17:2063806-2063828 AAGGGGCTGTGGTGGGCAGAGGG + Intronic
1142850196 17:2701056-2701078 CAGAAGCACTGGAGTGCAGGTGG + Intronic
1142960432 17:3548995-3549017 CTGGGGCACTGCAGGGCCGCAGG - Intronic
1143119165 17:4596602-4596624 CAGGGGACCTGGAGGGCTGTAGG + Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143450304 17:7032337-7032359 CAGAGGCCTTGGAGGACAGAGGG - Intergenic
1143892373 17:10112369-10112391 CAGGAGCAAGGTAGGGCAGATGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144753827 17:17667829-17667851 CACAGGCCCTGGAGGGCAGCAGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145735989 17:27232021-27232043 CTGGGATACTGTAGGGCAGAAGG + Intergenic
1145770316 17:27488047-27488069 CAGGGACACTGGGAGGCAGTGGG - Intronic
1145891923 17:28423093-28423115 CAAGCGCCCTGGAGGCCAGAAGG - Intergenic
1145940483 17:28740996-28741018 CTTGGGCTCTGGAGGTCAGAGGG + Intronic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146669429 17:34726660-34726682 CAGGGACACTGCAGGGCTGGGGG - Intergenic
1146911239 17:36649761-36649783 GGGGGGCACTGAGGGGCAGAGGG + Intergenic
1147047989 17:37768917-37768939 CAGGAGCACAGGAGGAGAGAAGG + Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148026340 17:44591560-44591582 AAGGGGACCTGCAGGGCAGAGGG + Intergenic
1148767827 17:50049519-50049541 GAGGGGCAGCGGAGGGCGGAGGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149454263 17:56775003-56775025 CAGGGGCACTGGATGACATGAGG - Intergenic
1149581758 17:57755644-57755666 CAGGGGCACTGCAGGCCAGTGGG - Intergenic
1149863832 17:60139504-60139526 GAGGGGCAATGGAGCGCGGACGG - Intergenic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150313489 17:64148822-64148844 AATGGGCACTGGCAGGCAGAGGG + Exonic
1150712582 17:67544419-67544441 GAGGGGCACTGGAGAAAAGATGG + Intronic
1151318303 17:73337347-73337369 CAGAGGCACAGGAGCCCAGAGGG - Exonic
1151329116 17:73396417-73396439 CAGGGGCTCTGGAGGGCCCTTGG + Intronic
1151701231 17:75743638-75743660 CAGGGTCACAGGAGAGCAGGAGG + Intronic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1152363694 17:79843726-79843748 CAGGGGCACGGGAGAGCCGCGGG - Intergenic
1152474949 17:80512034-80512056 CGTGGGCACTGCAGGGCAGCGGG + Intergenic
1152627010 17:81392530-81392552 CAGGGACATGGGAGGGCAGAGGG - Intergenic
1152721787 17:81927197-81927219 GAGGGGCACTGGACGGCGGGAGG - Intronic
1152790040 17:82273810-82273832 CGGGGTAACAGGAGGGCAGAGGG - Intergenic
1152817200 17:82415023-82415045 CTGGGGCACAGGACGGCAGAAGG + Intronic
1152956366 18:45256-45278 CAGGGGCCCAGGAGGGAACAGGG - Intergenic
1153498544 18:5724006-5724028 GAAGGGCACTGGAGGGCACTAGG + Intergenic
1153658747 18:7307874-7307896 CAGGGACACTGGAGGCCGCATGG + Intergenic
1154079152 18:11237171-11237193 CAGGGGCAGAGGAAGCCAGAGGG - Intergenic
1154307420 18:13240753-13240775 TAGGCGCTCTGGAGGGCAGCTGG - Intronic
1155957038 18:31962931-31962953 CAGGGACAGTGCAGGGCAGAAGG + Intergenic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1156560413 18:38118971-38118993 GAGGGTCACTGGAGCCCAGAAGG - Intergenic
1157191506 18:45586027-45586049 CGGTGCCACAGGAGGGCAGAGGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157564840 18:48672888-48672910 CAGGGCCACAGGATGGCAGGGGG - Intronic
1157622791 18:49025902-49025924 CAGAGGCCGTGGAGGCCAGAGGG - Intergenic
1157965734 18:52206182-52206204 CAAGGGCAGTGGAGGTCACAGGG + Intergenic
1158526996 18:58223950-58223972 CAGGAGCACAGGTGGGCAGTGGG + Intronic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160329953 18:77982236-77982258 CACGGGTACTGGAGGGTGGAGGG + Intergenic
1160481450 18:79244247-79244269 TAGGTGCACAGGAGGGCAGGGGG - Intronic
1160533536 18:79578903-79578925 CCAGGGAACTGGAGAGCAGAGGG - Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1160866471 19:1258404-1258426 CAGGGGCACTGAGAGGCAGGGGG - Exonic
1160989918 19:1856272-1856294 GAGGGGCACGGGAGGGTGGAGGG + Intronic
1161125778 19:2556414-2556436 CAGGGGCCCTTCAGGGCAGGAGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161984319 19:7645358-7645380 CCGGGGCTCTGCAAGGCAGAGGG + Intronic
1162094806 19:8304028-8304050 CAGGGGCAGGGGAGGCCAGGGGG + Exonic
1162778918 19:12996511-12996533 GAGGGGCAGGGGAGGGGAGAGGG + Intronic
1162800012 19:13105074-13105096 CAGGTGCCCTGGTGGGAAGATGG + Exonic
1163167648 19:15508758-15508780 CCGGGGCACTCGTGGGGAGAGGG + Intronic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1165121072 19:33558867-33558889 CAGGGGCTCTGGAGGCCGCACGG + Intergenic
1165148755 19:33749071-33749093 GAGAGGCCCTGGTGGGCAGAAGG + Intronic
1165349832 19:35269419-35269441 CAGGGGCACAGGAGGGAGCAGGG - Intronic
1165721246 19:38081539-38081561 CACGGGCACTGGAGTGCTGCTGG - Exonic
1165730895 19:38143925-38143947 CAGGGGCCCTGGTGGCCACAGGG - Intronic
1165809934 19:38606114-38606136 CAGGGCCACTGGGGGCCAGGAGG - Intronic
1166054132 19:40278648-40278670 AAGGGGCTCTGCAGGGCAGTGGG - Intronic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166154386 19:40899948-40899970 CAGGCACAGGGGAGGGCAGAAGG - Intergenic
1166568665 19:43780169-43780191 CAGGACCCCTGGAGGCCAGAGGG - Intronic
1166749019 19:45155975-45155997 TGGGGGCCATGGAGGGCAGATGG - Intronic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1168087147 19:54056583-54056605 CAGGGTCAATGAGGGGCAGAGGG - Intronic
1168449775 19:56457337-56457359 CAGGGGGACAGGTGGGCATAAGG + Intronic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925411623 2:3643043-3643065 TGGGGGCACTGCAGGGCTGAGGG - Intronic
925663085 2:6223397-6223419 CAGGGTCCCTGCAGTGCAGAGGG - Intergenic
925820979 2:7799624-7799646 CAGGGGCCATGCAGGGCAGCTGG - Intergenic
925926832 2:8676950-8676972 CACGGACGCTGGTGGGCAGAGGG + Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927381365 2:22482726-22482748 CAGGGGCTCTGGACCTCAGAGGG + Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928129500 2:28639517-28639539 CACGGTCACTGGAGGGGACATGG + Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
929164761 2:38870535-38870557 CAGAAACAATGGAGGGCAGAAGG + Intronic
930242791 2:48953641-48953663 GAGGCCCACTGGAGGGTAGAAGG + Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932488601 2:72104077-72104099 CAGGGACACAGAAGGGCAAAGGG + Intergenic
934852887 2:97712670-97712692 TTGGGGCACTAGAGGGGAGATGG + Intergenic
935543746 2:104378822-104378844 GAGGGGTACTTGAGGGCAAATGG - Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936522562 2:113220308-113220330 CAGGGACAATGGAGCTCAGAAGG + Intronic
937259218 2:120574776-120574798 CAAGGGCAGTAGGGGGCAGATGG - Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
938198910 2:129357072-129357094 GAGGGGCATTAGAGGGGAGAAGG - Intergenic
938277308 2:130037928-130037950 CAGGGCCACGGAAGGGCAGCGGG - Intergenic
938438075 2:131299450-131299472 CAGGGCCACGGAAGGGCAGCGGG + Intronic
939995061 2:148912193-148912215 CAGGGGCAGGGGCTGGCAGAAGG + Intronic
941255198 2:163220617-163220639 GAGGGGAACTGGATGGCTGAGGG - Intergenic
942229591 2:173847691-173847713 GAGGGGCTCTGGAGGGCAGAAGG + Intergenic
944145521 2:196503551-196503573 GAGGGGAACAGGAGGGCAGAAGG - Intronic
945896604 2:215489670-215489692 GTGAGACACTGGAGGGCAGAAGG + Intergenic
946007163 2:216535353-216535375 CAGGGGCACTTGAAGCCAGTGGG - Intronic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946408835 2:219506588-219506610 CAGGGGCACAGATGGGCAGGAGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947281427 2:228460071-228460093 GTGGGGCACTGGTGGGCACAGGG + Intergenic
947283994 2:228490159-228490181 CAAGGAAACTGGATGGCAGAAGG - Intergenic
947536347 2:230942476-230942498 AAGGGCCAATGGAGGGCAGGTGG + Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948335622 2:237204828-237204850 CAGTGACACTGGAGGACAGGTGG + Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948888582 2:240896233-240896255 CAGGGGCCATGCAGGGCAGGCGG + Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1168939852 20:1699980-1700002 CAGAAGCACTGGAAGCCAGAAGG + Intergenic
1169260109 20:4131498-4131520 CAGGGGCTCTGGAGGAGGGAGGG + Intronic
1169485392 20:6026855-6026877 AAGGGGCACTGGAGTGCAATAGG - Intronic
1170199097 20:13723186-13723208 AAAGTTCACTGGAGGGCAGATGG + Intronic
1170247625 20:14240678-14240700 CAGGCCTACTTGAGGGCAGAAGG + Intronic
1170555654 20:17512921-17512943 CAGGGGCACTGGCGGGTAAAGGG - Intronic
1171233820 20:23508800-23508822 TAGGAGCAGAGGAGGGCAGAAGG - Intergenic
1171448853 20:25222506-25222528 GAGGGGGAATGTAGGGCAGATGG + Intronic
1172004802 20:31811782-31811804 AAAGGACACTGGAGGGCAGATGG - Intergenic
1172010453 20:31843153-31843175 GAGGGCCTCTGGAGGGGAGAGGG + Intergenic
1172096691 20:32463907-32463929 CACGGCCACTGGAGGCCAGCAGG + Intronic
1172621633 20:36321381-36321403 CATGGGCCCTGGAGGGCTGCGGG + Intronic
1173208443 20:41013076-41013098 CAGGAACACTCTAGGGCAGAGGG + Intergenic
1173227920 20:41172675-41172697 GAGGGGCACTGTGGGGCAGCTGG + Intronic
1173531261 20:43771575-43771597 CAGGGGCAGTGGAGGAAAGGGGG - Intergenic
1174412212 20:50343584-50343606 CAGGGTCCCTGGTGGGCAGATGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175597127 20:60244200-60244222 CAGGTGCACTGGATGGAGGATGG + Intergenic
1175648912 20:60699653-60699675 CAGGATCACTGGATGGCAGAGGG - Intergenic
1175716764 20:61260173-61260195 AAGGAACACTGGAGGGTAGAGGG - Intronic
1175814326 20:61875685-61875707 CATGGCCACTGGAGGGCGGTGGG - Intronic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176215632 20:63946386-63946408 CACAGGCACTGGAGGGGAGCCGG + Intronic
1177144376 21:17391791-17391813 CATGGGAACTGGAGGGCAAGGGG - Intergenic
1178100998 21:29268406-29268428 GAGGGGCACTGAACAGCAGAGGG + Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179457137 21:41507711-41507733 CGGGGGCCGTGGAGGGCAGGCGG + Intronic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179999685 21:44989755-44989777 CAGCGGCTCTGGAGGGCATCGGG - Intergenic
1180081799 21:45490588-45490610 CAGGGACCCGGGAGGGCACACGG - Intronic
1180119288 21:45736201-45736223 AAGGGGCACTGGGAGGAAGAAGG - Intronic
1180170313 21:46055016-46055038 GAGGGGCTGTGCAGGGCAGAGGG - Intergenic
1181031878 22:20152278-20152300 CAGGGGCAGTGAGGGGCAGCAGG - Intergenic
1181169107 22:20998343-20998365 CAGGGGCAAGGCAGGGCAGAAGG - Exonic
1181198416 22:21204139-21204161 CATGGGCTCTGGCGGGCAGTAGG - Intergenic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181803721 22:25362736-25362758 TAGGGGCTGTGGAGAGCAGAGGG - Intronic
1183204142 22:36406853-36406875 CATGGGCACCGGAGGTCTGAGGG + Intergenic
1183327477 22:37202325-37202347 CAAGTCCACTGGAGGGCTGAGGG - Intergenic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1184152250 22:42645979-42646001 CAGGAGCAGTGGAGGGGCGAAGG + Intronic
1184176409 22:42791968-42791990 CAGGGGCACCTCAGGGCTGAGGG + Intergenic
1184196985 22:42936424-42936446 CAAGGGAACTGAAGGTCAGAGGG - Intronic
1184333701 22:43841178-43841200 CAGGGGCCCTGGAGGGCCACAGG + Intronic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184482942 22:44758734-44758756 CATGAGCTCTGGAGGGCAGCAGG + Intronic
1184675011 22:46036783-46036805 CAGAGGCCCTGGAGGGCAAAGGG + Intergenic
1184697675 22:46149377-46149399 CAGGGGAACTGGAGATCAGGCGG - Intergenic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185108780 22:48889340-48889362 CGGGGGCACTGGAGGGGAGAGGG - Intergenic
1203228391 22_KI270731v1_random:90698-90720 CATGGGCTCTGGCGGGCAGTAGG + Intergenic
949559497 3:5188384-5188406 CGGGGGCCCCGGAGGACAGAGGG - Intronic
950213618 3:11142040-11142062 AAGGGGTCCTTGAGGGCAGAGGG - Intronic
950446793 3:13043193-13043215 CAGGCGCATTGTTGGGCAGAGGG + Intronic
950687432 3:14628643-14628665 CAGGGGCAGTGGAGAGCGCACGG - Intergenic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951847845 3:27103651-27103673 CAGGGGCAAAGGAAGGCAGCGGG + Intergenic
952188830 3:31000457-31000479 CAGGGACACTGGAGGCTAAAAGG - Intergenic
952334545 3:32392677-32392699 AGGGGGCTCTGGAGGGCAGGGGG + Intronic
953190117 3:40677950-40677972 AAGGTGCACTGGTGGGCAGACGG - Intergenic
953914496 3:46909712-46909734 CATGGCCACTGGGGGGCAGCAGG - Intergenic
954130711 3:48559334-48559356 CAGGGCCATGGGAGGGGAGATGG - Intronic
954676305 3:52317615-52317637 AAAGGGCACAGGAGGGAAGATGG + Intronic
954871498 3:53770822-53770844 CGGGGGCACTGCAGGGCTGCAGG - Intronic
955155497 3:56413120-56413142 CAGGGTCACTGTAGTGCAAAAGG + Intronic
955712031 3:61790133-61790155 CATGGGCAGTGGAGTACAGAGGG + Intronic
956170116 3:66426550-66426572 CATGGGCACTGGAGGGACAATGG - Intronic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
957041774 3:75341318-75341340 CAGGAGCATTGGAGAGCAGCAGG - Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958822589 3:98992665-98992687 CAGGGGTTCAGGAGGTCAGAAGG - Intergenic
961387360 3:126530111-126530133 GATGGGCACAGGAGGTCAGAAGG - Intronic
961391257 3:126553461-126553483 CAGGGGTGGTGGGGGGCAGAAGG + Intronic
962383220 3:134913252-134913274 CAGGGGCATGGGAGGGGTGAGGG + Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962587456 3:136856788-136856810 GAGGGAGACTGGAAGGCAGAAGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967553913 3:190832029-190832051 CAGTGGCAATGGAGTCCAGATGG + Intergenic
967625722 3:191681526-191681548 GAAAGGCAATGGAGGGCAGATGG - Intergenic
967829842 3:193909486-193909508 CTGGGGCACTAGAGGGCTGCTGG - Intergenic
967888943 3:194351401-194351423 CAGGGTCACAGGACGGGAGAGGG + Intergenic
968138108 3:196233763-196233785 CAGGGGCCCTGGAGAACAGATGG + Intronic
968947738 4:3674543-3674565 CAGGAGCACAGGAGGGCTGTGGG + Intergenic
969310018 4:6347642-6347664 CAGGGACTCTGGGGGGCAGCAGG + Intronic
969512941 4:7629987-7630009 TAGGAGAACTGGAGGGGAGAGGG - Intronic
969530303 4:7726754-7726776 CAGGGGCACAGCAGGGCTTAGGG - Intronic
969593337 4:8134046-8134068 CATGGGCACAGGCGGGCGGATGG + Intronic
969693846 4:8724014-8724036 CAGGGGCGCTGCAGAGGAGAGGG + Intergenic
971473971 4:27055472-27055494 CAGGGGCACTAGAGGGCCAGGGG - Intergenic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
975148199 4:70993389-70993411 TGAGGGCGCTGGAGGGCAGAGGG - Intronic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
977822210 4:101486269-101486291 CAGGGGCTATGGAGAGGAGAGGG - Intronic
978479636 4:109174568-109174590 CTGTGGCACTGCAGGGCATATGG + Intronic
978564252 4:110065125-110065147 CAGTGGCACTGAAGAGCTGAAGG + Intronic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
982271914 4:153599195-153599217 CAGGAGCACGAGAGGGGAGAAGG + Intronic
982726466 4:158911403-158911425 CTGGGTCACTGGAGTGCACAGGG - Intronic
983728421 4:170961025-170961047 GAGGCCCACTGGAGGGTAGAGGG + Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985576143 5:674339-674361 GAGGAGCACTGGGGGGCACAGGG + Intronic
985615379 5:916934-916956 CAGGGGCTGTGGATGCCAGATGG + Intronic
985647172 5:1090418-1090440 CGGGGGCCCTGGAGAGGAGAGGG + Intronic
985872606 5:2569349-2569371 CAGGGGCCGTGGCGGGCAGCCGG + Intergenic
985965161 5:3333895-3333917 CAGGGGCGCTGGTGGGGGGATGG + Intergenic
987005211 5:13703563-13703585 CAGGGTCATTAGAGAGCAGAGGG - Intronic
987072620 5:14352202-14352224 CAGGGGATCTGCAGGCCAGAGGG - Intronic
987114580 5:14715905-14715927 CAGGGGAACCTGAGGCCAGATGG - Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
990818872 5:59815184-59815206 CAGGGGAACAGGAGAGCTGATGG + Intronic
991389469 5:66126711-66126733 GAGGGTCACTGGAGGCCAGGAGG + Intergenic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
993200030 5:84803901-84803923 GAGGGTCACTGGTGGACAGAGGG + Intergenic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994451538 5:99950457-99950479 GAGGGGGACTGGGGGGCTGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
997177866 5:131797334-131797356 CAGGAGCCTTGGAGTGCAGAAGG + Intergenic
997211796 5:132081211-132081233 AAGGGGCACTGGTGGGAAGCTGG + Intergenic
997596955 5:135113474-135113496 CAGGGGCAGAGGCGGGCAGGGGG - Intronic
999362755 5:150999623-150999645 CAGGGGAACAGGTGAGCAGATGG - Intergenic
999501214 5:152148360-152148382 GAGGGGCGCTGGAGGGGACAGGG + Intergenic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001381042 5:171306936-171306958 CCCGGGCACTGGAAGCCAGAAGG + Exonic
1001531966 5:172469691-172469713 CAGTGGCAGTGGAGGCCACATGG - Intergenic
1001686793 5:173599440-173599462 CAGGGGCCCTGTAAAGCAGAAGG + Intergenic
1001946584 5:175783864-175783886 CCTGAGAACTGGAGGGCAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002270449 5:178068416-178068438 CAGGGGCATGGGATGGGAGATGG - Intergenic
1002374082 5:178775707-178775729 CAGGGGCAGCTGAGGGCACAAGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002662853 5:180803077-180803099 CAGCTGCGCTGGAGGGCCGAGGG - Intronic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003516171 6:6820892-6820914 CAGGGGCAATGCAGGGGAGAGGG + Intergenic
1004030053 6:11859558-11859580 CAGGGGAACTGAAGGCCAGGGGG + Intergenic
1004278567 6:14259289-14259311 CAGGGGCTCCGGTGGGCAGCTGG + Intergenic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005971247 6:30763651-30763673 CAGAGGCAGTGGAGGGCTGGGGG - Intergenic
1006108013 6:31728317-31728339 CAGGGGCGCGGGAGGGGTGATGG + Intronic
1006449783 6:34099276-34099298 CAGGGGTACAGGTGGTCAGATGG + Intronic
1006639179 6:35480266-35480288 GAGGGGCCCAGGAGGGCTGAAGG + Intronic
1006780875 6:36631541-36631563 GAGGGGCATGGGTGGGCAGATGG + Intergenic
1007345175 6:41223690-41223712 CAGGGGATTTGGAGGGCAGTGGG - Intergenic
1007683225 6:43648800-43648822 CTGGGGCTCTGGAAGGCAGGTGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1009893325 6:69715776-69715798 AGGGCCCACTGGAGGGCAGAGGG - Intronic
1009960538 6:70515590-70515612 CAGGGGCTCTGGGGGACAGAGGG + Intronic
1011363646 6:86555392-86555414 AAAGGGGACTGGTGGGCAGATGG + Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014048627 6:116925574-116925596 CAGGTTGACTGGATGGCAGAGGG - Exonic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1016443752 6:144111313-144111335 AAGGTGCACTGCAGGGCAGCGGG + Intergenic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1017820605 6:158046385-158046407 CAGGGGGCCGGGAGGGCAGCGGG + Intronic
1019262750 7:91341-91363 GGTGGGCACTGGAGTGCAGATGG + Intergenic
1019571902 7:1716785-1716807 CAGGGGAACTGGAGGGCCTGGGG + Intronic
1019676196 7:2314154-2314176 CAGGCGCGCAGGAGGGCAGGGGG + Intronic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1020013581 7:4818791-4818813 GCGGGGCACTGGTGGGAAGAGGG + Intronic
1020134480 7:5579375-5579397 CGGGGACACTGGAGGTCAGCTGG - Intergenic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021900802 7:25283262-25283284 GATGGGCATTGGAGGGAAGATGG + Intergenic
1022509072 7:30923662-30923684 CAGGGGCAGGGGCGGGCGGAGGG + Exonic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023715728 7:43042354-43042376 AAGGGGCCCTGGTGGGTAGAGGG - Intergenic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1025140484 7:56459430-56459452 CATGGGCAGTGGGGGGCAGTTGG + Intergenic
1026501654 7:70947860-70947882 CAGTGGCACTGGTAGTCAGATGG - Intergenic
1026828862 7:73599797-73599819 CATGGGGACTGGCGGGCAGAGGG + Intronic
1026861584 7:73793507-73793529 CAGGGGTACTGCAGGTGAGAGGG + Intergenic
1027230232 7:76267983-76268005 CAGGGACTTTAGAGGGCAGAGGG - Intronic
1029055132 7:97733149-97733171 CAGGGGGATTGGAGGGCCGGAGG + Intronic
1029124393 7:98286616-98286638 CCCCAGCACTGGAGGGCAGAAGG - Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030053477 7:105560456-105560478 CGGGGGCACGGGAGGAGAGAGGG + Intronic
1031140762 7:117940507-117940529 GAGGGCGACTGGAGGGGAGAAGG + Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1032805103 7:135346296-135346318 CAAGCGCACTGGAGGCCACATGG - Intergenic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1034988037 7:155529583-155529605 CAAGGGCCCTGGGAGGCAGAGGG - Intronic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035046433 7:155970538-155970560 CAAGAGCCCTGGAGGGAAGACGG - Intergenic
1035058357 7:156051575-156051597 CAGAGGCACTGGAGTGCTAATGG - Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035428239 7:158796814-158796836 AAGGGGCACTGCAGGCGAGAGGG + Intronic
1035673660 8:1439391-1439413 CAGAGGCTCCGGAGGGCACAGGG - Intergenic
1036101139 8:5786506-5786528 CTGGCGCACAGGAGAGCAGAGGG - Intergenic
1036517310 8:9456318-9456340 GGGAGGCACTGGAGGACAGAAGG + Intergenic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1039117963 8:34113342-34113364 CAGGGGCACGGGAAGGGGGAAGG + Intergenic
1039202916 8:35116594-35116616 GAGGGCTACTAGAGGGCAGAGGG - Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1039806285 8:41002423-41002445 GATGGGCACTGCAGAGCAGAGGG - Intergenic
1040857438 8:51962369-51962391 CAGCTGCTCTGGAAGGCAGAAGG + Intergenic
1040945529 8:52881158-52881180 CAAAGGCACTGGAGGCCAGCTGG - Intergenic
1041793330 8:61720584-61720606 GAGAGGCACTGCAGGGCTGAAGG - Intergenic
1042864555 8:73345767-73345789 CCTGGGCACTGCAGGACAGAGGG - Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044925842 8:97208164-97208186 CAGGGTCATTCTAGGGCAGAGGG + Intergenic
1047105353 8:121725300-121725322 CAAGGACACTGTAGGGCACAGGG - Intergenic
1048402042 8:134081293-134081315 CAGGAGCAGTGGGAGGCAGATGG - Intergenic
1048972046 8:139650605-139650627 CAGGGACCCTGGAGTGGAGAGGG - Intronic
1049007347 8:139863825-139863847 GAGGGGCACGGGAGGGGATATGG + Intronic
1049031835 8:140043863-140043885 GAGGGCCACTGGAGGGGAGAGGG - Intronic
1049414056 8:142487424-142487446 CAGCCCCAGTGGAGGGCAGAGGG - Intronic
1049473687 8:142787355-142787377 CTGGGGCCCTGGAGGGCGGGAGG - Intergenic
1049804388 8:144532389-144532411 CAGGGACCCTGCAGGGCACAGGG + Exonic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050350253 9:4734377-4734399 CATGGGAGCAGGAGGGCAGATGG - Intronic
1052059089 9:23938838-23938860 CAGGGGTACTGGAGTCCTGAAGG - Intergenic
1052531281 9:29687581-29687603 CAGAAACAATGGAGGGCAGAAGG + Intergenic
1052792706 9:32890776-32890798 CAGGGTCACTGGAGGTGTGATGG - Intergenic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053304553 9:36974929-36974951 CAGGGGCACTGGGGAGCAGTGGG - Intronic
1055977838 9:81971956-81971978 CAGGCTCACTAGAGGGCAGCAGG - Intergenic
1056832738 9:89929860-89929882 CAGGGGCAGAGGAAGGGAGAAGG + Intergenic
1058382823 9:104396614-104396636 CAGGGGCAGCGAAGGGGAGATGG + Intergenic
1058896862 9:109407920-109407942 AAGGGGCACTGGTGGAAAGATGG + Intronic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059575482 9:115483826-115483848 CAAGGGCAAAGGATGGCAGATGG - Intergenic
1060206876 9:121687311-121687333 CAGGGACACTGGATGGAACAAGG + Intronic
1060218359 9:121751826-121751848 CCAGGGCATGGGAGGGCAGAGGG - Intronic
1060319022 9:122538140-122538162 CAGGGGGACTGGGGGGCTGTTGG - Intergenic
1060421639 9:123473319-123473341 GAGGGGCAGGGGAGGGCGGAGGG + Intronic
1060447968 9:123709275-123709297 CTGGGGCACTGGTGCTCAGAGGG - Intronic
1060733184 9:126050609-126050631 GAGGGGTACGGGAGGGGAGAGGG - Intergenic
1061040046 9:128136004-128136026 CAAGGGCCCTAGAGGCCAGATGG - Intergenic
1061137289 9:128742192-128742214 CATGGGCCCTGGAGGCCAGTGGG - Intronic
1061183770 9:129040247-129040269 CAGGGCCCCTGGTAGGCAGAGGG + Intronic
1061249820 9:129420230-129420252 GCGGGGCCCTGGAGGGGAGATGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061412717 9:130430018-130430040 CTGGGGCACTGAAGGGCTGAGGG + Intronic
1061664885 9:132154828-132154850 CCGGGGCAGTGGGAGGCAGAGGG + Intergenic
1062051350 9:134448678-134448700 CAGTGTCACTGGAGGGCATGTGG + Intergenic
1062143422 9:134973061-134973083 GGAGGGCACTGGAGGGGAGACGG + Intergenic
1062522053 9:136961971-136961993 CAGGGGGACAGGTGGGCTGAGGG + Intergenic
1062549618 9:137079979-137080001 CTGGGGCACGGGAGAGCAGAGGG - Intronic
1062699191 9:137890273-137890295 CATGGGGACTGGAGAGCTGAAGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1062741837 9:138179523-138179545 CAGGGGCCCAGGAGGGAACAGGG + Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1187269320 X:17765425-17765447 CATGGGCACAGGAAGGCATAAGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1189526177 X:41824435-41824457 GAGGGGCACTGGAGGAGAAAGGG + Intronic
1190321824 X:49184317-49184339 GAGGGGTGCTGGAGGCCAGAGGG + Intronic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1190723716 X:53172360-53172382 CTGGGGCACTGGAAGTAAGATGG - Intergenic
1190913246 X:54790840-54790862 CATGGGCATTGGTGCGCAGACGG + Exonic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1195636368 X:107120325-107120347 TAGGGGAACTGGATGGCTGAGGG + Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1197461889 X:126752854-126752876 CAGGAACACTGGAAGGTAGACGG + Intergenic
1197782650 X:130172619-130172641 CAGCGGCACCTGTGGGCAGAGGG + Intronic
1200066162 X:153505050-153505072 CAGGGACACTGACGGGCACACGG - Intronic
1200079105 X:153566765-153566787 CAGTGGCACAGGCGGGCAGAGGG - Intronic
1202095097 Y:21241598-21241620 CAGATGCAATGGAGGCCAGAGGG + Intergenic
1202168571 Y:22017518-22017540 CAGGATCACTGGAGGCCAAAAGG + Intergenic
1202222790 Y:22568850-22568872 CAGGATCACTGGAGGCCAAAAGG - Intergenic
1202320325 Y:23626810-23626832 CAGGATCACTGGAGGCCAAAAGG + Intergenic
1202550442 Y:26043246-26043268 CAGGATCACTGGAGGCCAAAAGG - Intergenic