ID: 1148874024

View in Genome Browser
Species Human (GRCh38)
Location 17:50675911-50675933
Sequence GGTACAGAGCCCCACGGCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148874024_1148874033 27 Left 1148874024 17:50675911-50675933 CCAAGGCCGTGGGGCTCTGTACC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1148874033 17:50675961-50675983 GGTCAAAGTGCGGCTGCCATTGG 0: 1
1: 0
2: 0
3: 7
4: 56
1148874024_1148874028 5 Left 1148874024 17:50675911-50675933 CCAAGGCCGTGGGGCTCTGTACC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1148874028 17:50675939-50675961 GGCCATCTGTCTCCTGTATGTGG 0: 1
1: 0
2: 0
3: 13
4: 158
1148874024_1148874029 6 Left 1148874024 17:50675911-50675933 CCAAGGCCGTGGGGCTCTGTACC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1148874029 17:50675940-50675962 GCCATCTGTCTCCTGTATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 160
1148874024_1148874032 17 Left 1148874024 17:50675911-50675933 CCAAGGCCGTGGGGCTCTGTACC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1148874032 17:50675951-50675973 CCTGTATGTGGGTCAAAGTGCGG 0: 1
1: 0
2: 2
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148874024 Original CRISPR GGTACAGAGCCCCACGGCCT TGG (reversed) Exonic