ID: 1148875879

View in Genome Browser
Species Human (GRCh38)
Location 17:50686895-50686917
Sequence GGGATGCTGTGGCCTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148875871_1148875879 14 Left 1148875871 17:50686858-50686880 CCTTTGGGAAGGGCTGAGGTATT 0: 1
1: 0
2: 2
3: 7
4: 193
Right 1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG 0: 1
1: 0
2: 2
3: 28
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148875879 Original CRISPR GGGATGCTGTGGCCTCTGGT TGG Intronic