ID: 1148875879

View in Genome Browser
Species Human (GRCh38)
Location 17:50686895-50686917
Sequence GGGATGCTGTGGCCTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148875871_1148875879 14 Left 1148875871 17:50686858-50686880 CCTTTGGGAAGGGCTGAGGTATT 0: 1
1: 0
2: 2
3: 7
4: 193
Right 1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG 0: 1
1: 0
2: 2
3: 28
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148875879 Original CRISPR GGGATGCTGTGGCCTCTGGT TGG Intronic
900651313 1:3731316-3731338 GGGATGCCGTGGCCACCTGTGGG + Intronic
900673664 1:3870826-3870848 GGGAAGCAGTGGGCTCTGCTGGG + Intronic
900937901 1:5778517-5778539 GGAATACTGTGGGCTCTGGAAGG + Intergenic
901127703 1:6941003-6941025 GGGAAGGTGTGTCCTCAGGTAGG + Intronic
901602507 1:10432897-10432919 GGTAAGCTGAGGCCTCTGGTAGG - Intronic
904212222 1:28893553-28893575 GGGACGCTGCTGCCTCTAGTGGG + Intronic
904808226 1:33146569-33146591 ATGATGCTGTGGCCTGTGGAAGG - Exonic
905631033 1:39518688-39518710 GGGAGGCTCTGGGCTCTGGAAGG + Intronic
905666727 1:39767488-39767510 GGGAGGCTCTGGGCTCTGGAAGG - Intronic
905923091 1:41732057-41732079 GGAAGGCTGTGGCATGTGGTGGG + Intronic
905930425 1:41783075-41783097 GGGATGCAGCTGACTCTGGTGGG + Intronic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
914723463 1:150308219-150308241 GGGCTGCTGAGGCCTGTGGGTGG + Exonic
915304932 1:154971646-154971668 AGGATGCTGTGCTCTTTGGTGGG - Intronic
915645920 1:157272265-157272287 GGGATGCTGTGTCTTCATGTGGG - Intergenic
915707607 1:157861451-157861473 GGGCTGCTGAGGCCTGTGGATGG + Intronic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
920050506 1:203162038-203162060 GGGATGCTGTGGACTTGGGAGGG + Intronic
922797694 1:228349121-228349143 GGGCTGCTGTGTCCTCTGCAGGG + Intronic
922981846 1:229833627-229833649 GGCAGGCTGTGGCTTCTCGTGGG - Intergenic
924772237 1:247088342-247088364 TGGCTGCTATGGCATCTGGTGGG - Intergenic
1062987776 10:1785412-1785434 GAGATGCTCTGGCCTCGGGGAGG - Intergenic
1063333272 10:5183985-5184007 GGGCTCCAGTGGGCTCTGGTGGG + Intergenic
1066455637 10:35569180-35569202 GGGATGGTGTGGCCTCCGGCGGG - Exonic
1068889021 10:62129127-62129149 GGGAGGCTGAGACCTCAGGTGGG - Intergenic
1069630770 10:69895736-69895758 GGGATGGTGGTGCGTCTGGTGGG + Intronic
1071570273 10:86692839-86692861 GGGCTGCTTTGGCCTTTGCTGGG + Intronic
1071987405 10:91066127-91066149 GGGAGGCTCTGGCTTCTGGCTGG - Intergenic
1072221515 10:93331386-93331408 GGGGTGCTGTAGGCTCTGCTCGG - Intronic
1072464269 10:95648758-95648780 GGGATGAAGGGGCCTCTGCTGGG - Intronic
1075803341 10:125166931-125166953 GGGCTGCTGAGGCCTGTGGATGG + Intergenic
1076205022 10:128590695-128590717 GGGATGCTGTGACTTCAGGTGGG + Intergenic
1076705172 10:132297420-132297442 GGGCTGGCGTGGCCCCTGGTGGG - Intronic
1077706646 11:4493206-4493228 TGGATGCTGTGGCCTCCAGATGG + Intergenic
1077918010 11:6623456-6623478 GGGATGCTGGGGCTTTTGGGAGG - Exonic
1081547202 11:44079830-44079852 GGGATCCTGAGGCCTCTTCTTGG - Intronic
1081567815 11:44270626-44270648 GGGTTGGTGTGGCATCTGGAAGG - Intronic
1081676347 11:44972190-44972212 GGGATGCTGAGACCTCAGGTGGG - Intergenic
1083339162 11:61947559-61947581 GACATGCTGGGGCCTCTGGGAGG + Intergenic
1083989251 11:66236659-66236681 GCCATGCTCTGGCCTCTGGCAGG - Intronic
1084371280 11:68745900-68745922 GAGATGCTGTGGCTTCTGCCTGG + Intronic
1084657396 11:70527428-70527450 GGAATGGTGTGGGCTCAGGTGGG + Intronic
1084937194 11:72593238-72593260 GGGATGCTGTGGACACTGTAAGG - Intronic
1084958347 11:72703285-72703307 GGGATCCCCTGGCCTCTGCTAGG - Intronic
1085391257 11:76183491-76183513 TGGATGCTGGGGCCTCTGCCAGG - Intergenic
1088708485 11:112484791-112484813 GGAGGGCTGTGTCCTCTGGTGGG + Intergenic
1089779896 11:120866385-120866407 GGGATGCTGTGGACCCTGCCTGG - Intronic
1089885211 11:121814832-121814854 GGGATGATCTGGGCACTGGTTGG + Intergenic
1090076402 11:123582462-123582484 GGGAGGGTGTGGCCTCTGGATGG + Intronic
1092158270 12:6299306-6299328 GGGATGTTGTGGGCTCAGATAGG + Intergenic
1099937030 12:89138600-89138622 GTGATGCTGATGCTTCTGGTTGG - Intergenic
1105715728 13:23062302-23062324 GGTATGCTGTGGCTTCTTCTAGG - Intergenic
1105786937 13:23759381-23759403 GGGATCCTGTGCTGTCTGGTGGG - Intronic
1106102984 13:26710248-26710270 GGGAAGCTGGGGCCACTGGTTGG + Intergenic
1106115462 13:26814142-26814164 GGGATGCTCGGGCCTCTGCCTGG + Intergenic
1106472124 13:30065389-30065411 GGGCTGCTGTGGCCTGGGGGAGG + Intergenic
1110953950 13:81529592-81529614 GGAATCTTGTGGCCTCTGGCTGG - Intergenic
1111929776 13:94501743-94501765 GTAATGCTGTGCCCTCTGCTTGG - Intergenic
1112576751 13:100642959-100642981 GGGATGTTTTGGCTTCTTGTTGG - Intronic
1113840884 13:113360654-113360676 GGGATGCTGGTGACTCCGGTGGG - Intronic
1116654880 14:47639710-47639732 GGGAAGCAGCAGCCTCTGGTAGG - Intronic
1119695889 14:76713303-76713325 GGGTGGCTGTGGCCTCGGTTAGG - Intergenic
1120683390 14:87508101-87508123 GGAATGCTGTGTCCTCTGGAGGG - Intergenic
1122018009 14:98813277-98813299 GGCAGGCTCTGGCCTCTAGTTGG - Intergenic
1122115848 14:99526875-99526897 GAGCTGCTGGGGCCCCTGGTGGG - Intronic
1122147728 14:99703128-99703150 GTGATGCTGTGTCCTCTGTGGGG + Intronic
1122396649 14:101437582-101437604 GGGTTCCGGTGGGCTCTGGTGGG + Intergenic
1122772128 14:104102222-104102244 CTGATGCTGTGGGCTCTGGTGGG + Intronic
1122858489 14:104571612-104571634 GGGCTGCTGCAGCCTCTGCTGGG - Intronic
1122968831 14:105144213-105144235 GGGTTGCTGTGGCCTCGTGAAGG - Intronic
1123153101 14:106201509-106201531 TGGATCCTGTGGCCTCAGGATGG - Intergenic
1123472604 15:20566255-20566277 GGGATGGGGTGGACTCTGGGGGG - Intergenic
1123645399 15:22434098-22434120 GGGATGGGGTGGACTCTGGGGGG + Intergenic
1123732909 15:23161246-23161268 GGGATGGGGTGGACTCTGGGGGG - Intergenic
1123751042 15:23358623-23358645 GGGATGGGGTGGACTCTGGGGGG - Intronic
1123934707 15:25188502-25188524 AGGAAGGTGTGGCCCCTGGTGGG - Intergenic
1124283415 15:28382541-28382563 GGGATGGGGTGGACTCTGGGGGG - Intronic
1124299283 15:28529072-28529094 GGGATGGGGTGGACTCTGGGGGG + Intronic
1125304672 15:38296992-38297014 TGAATGCTGTGACCTCTGGAGGG - Intronic
1125746866 15:42003197-42003219 GGGATGCTGTGGACTCTGCCAGG - Intronic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1128880254 15:71236081-71236103 GGGATGCTGTGGCCCGTGTGGGG + Intronic
1128997283 15:72306380-72306402 GGGATGGAGTGGCCCCTGATTGG - Intronic
1130944863 15:88543239-88543261 TGGATCCTGTGGCCTCTGGATGG + Intronic
1132553972 16:564693-564715 GTGATGCTGTGGCCTGAGGACGG + Exonic
1132769091 16:1551175-1551197 GGGAAGCTGTGGTCAATGGTGGG + Intronic
1132831406 16:1930042-1930064 GTGGGGCTGTGGCCCCTGGTGGG - Intergenic
1135284534 16:21182070-21182092 GGGATACTGTGCCCTCTGCTAGG - Intergenic
1135934858 16:26771144-26771166 GTGTTGCTGAGGCTTCTGGTTGG - Intergenic
1137005500 16:35271721-35271743 TGGACCCTGTGGCCTCTGGGTGG - Intergenic
1137783148 16:51114630-51114652 GGGAAGCTGCAGTCTCTGGTTGG - Intergenic
1141938081 16:87255243-87255265 GGGCTGCTGTGGTCACTGCTGGG + Intronic
1142356954 16:89605807-89605829 GGGATGCGTGGGCCTCCGGTGGG + Intergenic
1142600069 17:1049515-1049537 GGGAGTCTGTGGCTTCGGGTGGG - Intronic
1143508807 17:7384180-7384202 GGGCTGGTGCGGCCTCTGGGCGG + Exonic
1143959861 17:10707661-10707683 GGGCAGCAGTGGCCTCTGTTTGG - Intronic
1146676506 17:34776934-34776956 GGGATGCTGAGGCTCCTGGCTGG + Intergenic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1149470286 17:56910792-56910814 GGGTTGCCTTGGCCACTGGTGGG - Intronic
1151603845 17:75124087-75124109 CTGTTGCTGTGGCCTCTTGTGGG + Intronic
1151830618 17:76547220-76547242 AGGATGTGGTGGCCTCTGGCAGG + Intronic
1152381474 17:79944594-79944616 GGGCTGCTGTGGCCTAGTGTAGG + Intronic
1152543268 17:80987787-80987809 GATTTGCTGTGGCCTCTGGTTGG + Intergenic
1152728190 17:81957917-81957939 GGGAGGGGGTGGCCTCAGGTAGG + Intronic
1153912305 18:9715058-9715080 GGGATGGAGAGGCTTCTGGTTGG + Intronic
1154040408 18:10849458-10849480 GGGAATCTGTGGCCTCTGAGAGG - Intronic
1155587235 18:27380742-27380764 GGGAGGCTGTGGGCTCTGTGTGG + Intergenic
1158494901 18:57946013-57946035 GTGATGTTCTGCCCTCTGGTAGG - Intergenic
1160014122 18:75127718-75127740 GGGAGGCTGGGGCTCCTGGTGGG - Intergenic
1160054277 18:75464664-75464686 GGGTGGCTGTGGGCTCTGCTGGG - Intergenic
1160157714 18:76446233-76446255 TGGATGCTGTGGGCTCTGAGGGG - Intronic
1160235058 18:77079037-77079059 GGGATGATGTGCCCTCCTGTGGG - Intronic
1160536873 18:79599212-79599234 GGGCTGCTCTGGGCTCTGGCTGG - Intergenic
1161815770 19:6498984-6499006 GAGATTCTATGGCCTCTGGGTGG + Intronic
1162930227 19:13953855-13953877 GGGCAGCTCTGGCCTCTGCTGGG - Intronic
1163075868 19:14891016-14891038 TGGACGCAGTGGGCTCTGGTGGG + Intergenic
1163533858 19:17866053-17866075 GGTATGCAGTGGGCTTTGGTGGG - Intergenic
1163928583 19:20367463-20367485 TGGATCCTGTGGCCTCTGGATGG + Intergenic
1168246379 19:55114812-55114834 GGGCTGGGGTGGCCTCTCGTGGG + Intronic
1168346129 19:55651012-55651034 GGGGTCCTGAGGCCCCTGGTCGG + Intronic
1168468843 19:56625005-56625027 GGGATGCTGTGGTACCAGGTGGG + Exonic
1168706618 19:58473988-58474010 GGGATGGAGTGCCCACTGGTTGG - Intergenic
925029826 2:641844-641866 GGGAAGTTGGGGGCTCTGGTTGG + Intergenic
925064144 2:916068-916090 GGGATCCTGTGTCCTGTGCTGGG - Intergenic
925881427 2:8356064-8356086 GGGAAACTTTGGCCCCTGGTTGG + Intergenic
927515379 2:23668989-23669011 GGAAGGCTGTGGCCCATGGTGGG + Intronic
928100066 2:28431778-28431800 GGGGTGCTGGGCCCGCTGGTGGG - Intergenic
929568947 2:43007709-43007731 GGGTTGGTGTGGGATCTGGTGGG - Intergenic
930018591 2:46987186-46987208 GGGCAGCCGTGGACTCTGGTTGG + Intronic
930819258 2:55629215-55629237 GGGAGGCTGAGGGCTCAGGTAGG - Intergenic
938409298 2:131050822-131050844 TGAGTGCTGTGGGCTCTGGTGGG - Exonic
939200887 2:139032022-139032044 GGGATGTTGTGCCACCTGGTGGG + Intergenic
940195774 2:151092464-151092486 GTGCTGCTGTGCCTTCTGGTGGG - Intergenic
942154687 2:173115821-173115843 GGGATGCAGTGGACTCTGTGAGG + Intronic
945072453 2:206005052-206005074 GGCAGGATGTGGCCTCTGGGAGG + Exonic
946009816 2:216555479-216555501 GGGCTGCTTTGGCTTCTTGTGGG - Intronic
947712424 2:232323748-232323770 AGGGTGCCGTGGCCTCTGGGTGG - Intronic
947719813 2:232363563-232363585 AGGGTGCCGTGGCCTCTGGGTGG - Intergenic
947731383 2:232433428-232433450 AGGGTGCCGTGGCCTCTGGGTGG - Intergenic
947918643 2:233850898-233850920 GGGAGGCTGTGGGCCCTGGCAGG - Intronic
948485842 2:238280216-238280238 GGGATGCTGAAGGCTCTTGTTGG - Intronic
948974903 2:241458082-241458104 GGGATGCTGTGGCCTCAGGGTGG + Intronic
1170785311 20:19462444-19462466 GGGCTGCTGTTGCCTGGGGTTGG + Intronic
1171019107 20:21568980-21569002 GGAATGCTGTGAAGTCTGGTTGG + Intergenic
1172355659 20:34277942-34277964 GGGAAGATGAGGCCTGTGGTTGG - Intergenic
1172514402 20:35523039-35523061 GGGATCTTGTGGCCTCTGTAGGG + Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173737814 20:45374092-45374114 AGGGTGCTGTGGTGTCTGGTAGG + Intronic
1174197607 20:48784758-48784780 GAGCTGCTGTGGGCTCAGGTGGG - Intronic
1174364626 20:50048968-50048990 GGGATGATGTCGCCTCTGGAGGG - Intergenic
1174568585 20:51484772-51484794 GAGATGCTGTCACCTCTGTTCGG - Intronic
1174978951 20:55369998-55370020 GGGATGCTCTGGTGCCTGGTGGG - Intergenic
1175834689 20:61985999-61986021 GGGATGGTGTTTCCTTTGGTTGG - Intronic
1175834718 20:61986109-61986131 GGGATGGTGTTTCCTTTGGTTGG - Intronic
1175834752 20:61986241-61986263 GGGATGGTGTTTCCTTTGGTTGG - Intronic
1175834758 20:61986263-61986285 GGGATGGTGTTTCCTTTGGTTGG - Intronic
1175834797 20:61986417-61986439 GGGATGGTGTTTCCTTTGGTTGG - Intronic
1175834817 20:61986505-61986527 GGGATGGTGTTTCCTTTGGTTGG - Intronic
1175931291 20:62494993-62495015 GGAATGCTGGGGGCGCTGGTGGG + Intergenic
1176004684 20:62854347-62854369 AGGATGCTCTGGCCTCTGGAAGG - Intronic
1176222099 20:63974589-63974611 GGGTTGCTCAGGCCTCTGGGAGG + Exonic
1176425484 21:6545859-6545881 GTGTTGCTGCGGCCTCTGGCTGG - Intergenic
1179086568 21:38223451-38223473 GGGATGCTGTGAAATCTAGTTGG + Intronic
1179135026 21:38671789-38671811 GGGACGATGTGGCCTGTGGTGGG - Intergenic
1179700975 21:43154176-43154198 GTGTTGCTGCGGCCTCTGGCTGG - Intergenic
1179982795 21:44905347-44905369 CAAATGCTGTGGCCTCTGGGAGG - Intronic
1180136712 21:45866753-45866775 GGGGTGCTGGAGCCTCTGGCAGG - Intronic
1180301264 22:11038144-11038166 GCGATGCTGGAGCTTCTGGTGGG - Intergenic
1180847633 22:18992725-18992747 GGCAAGGTGTGGCCTCTTGTGGG - Intergenic
1181116676 22:20635958-20635980 GGGATCCAGTGGCCTCTTTTTGG - Intergenic
1182230119 22:28831537-28831559 TGGGTGCTGTTGTCTCTGGTGGG + Intergenic
1184472460 22:44703334-44703356 GGGAGGCTGTGGACACTGTTCGG + Intronic
1184799016 22:46748832-46748854 GCGAAGCAGTGGCCTCTGGGAGG - Intergenic
1185051337 22:48555804-48555826 GGGGCGCTGTGGCCGCTGGCTGG + Intronic
1185222266 22:49635030-49635052 GTGATTCTGTGTCCCCTGGTGGG - Intronic
1185222281 22:49635114-49635136 GGGATTCTGTGTCCCCAGGTGGG - Intronic
1185313600 22:50169821-50169843 GGGGTGCTGCGGCCACTGGCGGG - Intergenic
949615528 3:5749855-5749877 GGTGTGCTGTGCCCTCTGATTGG + Intergenic
950142811 3:10627127-10627149 GGGAAGCTTTGGCATCTGGCAGG - Intronic
950315484 3:11998341-11998363 GAGAAGCTCTGGCCTCTTGTGGG - Intergenic
951048461 3:18067478-18067500 GGAATGCTGTGTCCTCATGTGGG - Intronic
951639525 3:24820789-24820811 GGTATGCTGAGGCTTCTGGGTGG + Intergenic
954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG + Exonic
961134454 3:124496728-124496750 GGGCTGCTGTGCCTTCTGGGGGG + Intronic
961431459 3:126886889-126886911 GGGAAGCTGGGGCTTCTGATGGG - Intronic
961445190 3:126977209-126977231 GGGCTGCAGTGGCTCCTGGTGGG + Intergenic
963525222 3:146408190-146408212 TGGATCCTGTGGCCTCTGGATGG - Intronic
964317197 3:155457213-155457235 TCTATGCTGTGGCCTCTGCTGGG + Intronic
965104149 3:164337892-164337914 TGGATCCTGTGGCCTCCGGATGG - Intergenic
966416578 3:179695389-179695411 GGGAAGCTGAGGCCACTGGCTGG + Intronic
967956436 3:194880970-194880992 GGGATTCTTTGGTCTGTGGTGGG - Intergenic
969861020 4:10035349-10035371 GGGATGCTCTGGCCTCCTGGGGG + Intronic
970539747 4:17065525-17065547 TAGAAGCTGTGGCCTCTGGTAGG + Intergenic
971743403 4:30549443-30549465 TGAATGCTGTGTCCTCTGGAGGG + Intergenic
972511543 4:39771751-39771773 GGGATGCTGATGCTGCTGGTTGG + Intronic
975534588 4:75435863-75435885 GGCTTGCTGTGGCTGCTGGTGGG - Intergenic
979063119 4:116092966-116092988 GAGATTCAGTGACCTCTGGTTGG + Intergenic
980788587 4:137587912-137587934 GGTCTGGTGTGGCCTCTGCTAGG + Intergenic
985631745 5:1017650-1017672 GGGGGGCTGTGGGCTCTGGGAGG - Intronic
986181854 5:5400511-5400533 GTGAGGCTGTTGCCTCTGGGAGG + Intergenic
987341700 5:16945044-16945066 AGGAATCTGTGGCCACTGGTGGG + Intergenic
992351069 5:75929401-75929423 GGGAAGCTGCGGCATCTGCTTGG + Intergenic
992895403 5:81240875-81240897 GGGTTGCTGTGGCAAGTGGTGGG + Intronic
993587637 5:89750738-89750760 GGGAAGCTATGGACTCTGTTTGG + Intergenic
994081195 5:95710511-95710533 TGGATCCCGTGGCCTCTGGATGG - Intergenic
995995958 5:118299789-118299811 AGGCTGCTGTGGGCTCTGCTTGG - Intergenic
996838845 5:127823966-127823988 CAGCTGATGTGGCCTCTGGTTGG - Intergenic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1000298975 5:159937960-159937982 GGGAAGCTTTGGCCTCCAGTGGG - Intronic
1001546565 5:172574173-172574195 GGACTGCTGTGTCCTCTGGCTGG + Intergenic
1001555937 5:172637287-172637309 GGGCTGCAGGGGCCTCTGGGTGG - Intergenic
1001687042 5:173601255-173601277 GGGATGATGGGGCATCGGGTCGG + Intergenic
1002056208 5:176599235-176599257 GGGATCCTGTGGCTCCTGGAAGG - Exonic
1003453709 6:6261472-6261494 GAGATGCTGTTGCTGCTGGTCGG - Intronic
1005738489 6:28770612-28770634 TGGATCCTGTGGCCTCTGGATGG - Intergenic
1005873432 6:29994401-29994423 AGGGTGCTGTGGGCACTGGTGGG + Intergenic
1006804994 6:36782318-36782340 TGGATTTTGTGGCCTCTGTTTGG - Intronic
1007090391 6:39180798-39180820 GGGATGCTGGGCCCTCTCCTAGG - Intergenic
1007268865 6:40620529-40620551 GAGAGGCTGTTGCCTCAGGTGGG + Intergenic
1007370257 6:41422227-41422249 GGGATGCTGGGGCAGCTGGCAGG - Intergenic
1007406611 6:41639242-41639264 GGGAAGCGCTGGGCTCTGGTTGG - Intronic
1008646463 6:53519432-53519454 GGTATCCAGTGGACTCTGGTGGG - Intronic
1010812337 6:80314793-80314815 GGGGAGCTCAGGCCTCTGGTGGG + Intronic
1011356494 6:86477244-86477266 TGGATCCTGTGGCCTCTGGATGG + Intergenic
1011507924 6:88068202-88068224 GGGTTGCTGGAGCCCCTGGTTGG + Intergenic
1014124270 6:117759141-117759163 GGGTTGCTGTAGACCCTGGTTGG - Intergenic
1015473678 6:133635280-133635302 GGCATGCTGTGGCAGCTGGAAGG + Intergenic
1016425634 6:143933505-143933527 GGGTTGCTGTGGCCACTGTGGGG + Intronic
1018962766 6:168459775-168459797 GGGGTGGTGAGCCCTCTGGTGGG + Intronic
1019265525 7:115369-115391 GGGAAGCTGTGGCCAGTGGAGGG - Intergenic
1019741272 7:2675705-2675727 GGTTTGCTGTGGCCTCCAGTGGG - Intergenic
1022013398 7:26328610-26328632 GGGAATCTGTGGCTTCTGCTAGG + Intronic
1022150287 7:27596191-27596213 TGAATGCTGTGTCCTCTGGAGGG + Intronic
1022358853 7:29640817-29640839 TGGACCCTGTGGCCTCTGGGTGG - Intergenic
1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG + Intergenic
1023996206 7:45160534-45160556 GGGAGGCTGTGGATTCTGGGCGG - Intronic
1026885944 7:73945348-73945370 GGAATGCTATGTCATCTGGTAGG + Intergenic
1027269290 7:76511356-76511378 GGGAGGATGTGGCCTCCTGTGGG + Intronic
1027320003 7:77005251-77005273 GGGAGGATGTGGCCTCCTGTGGG + Intergenic
1027350408 7:77306111-77306133 AGGGTGCAGTGGACTCTGGTGGG + Intronic
1029510654 7:100992778-100992800 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029511143 7:100996027-100996049 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029511871 7:101000698-101000720 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029512363 7:101003947-101003969 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029512444 7:101004526-101004548 GGGCTGCTGTGGTAGCTGGTAGG - Exonic
1029691242 7:102183452-102183474 AGGATACTGTGGACTCTGGACGG - Intronic
1031483137 7:122301854-122301876 GGGATGCAGAGGCTTCTGGTCGG + Exonic
1031741809 7:125442300-125442322 TGGATGCTGTGTCCTCTGGCGGG - Intergenic
1031799400 7:126223593-126223615 GGCTTGCTGTGGCCACTGCTGGG + Intergenic
1032721435 7:134553471-134553493 TGGACCCTGTGGCCTCTGGGTGG + Intronic
1034350352 7:150411176-150411198 GGACTGCTGTGGACGCTGGTGGG + Intronic
1034416854 7:150969867-150969889 TCTATGCTGTGGCCTGTGGTTGG - Intronic
1035418500 7:158708218-158708240 GAGATGATGAGGCCTGTGGTAGG - Intergenic
1035589562 8:802349-802371 GGGAAGCTGTGGCCTGAGGTGGG - Intergenic
1038015356 8:23510058-23510080 AGTATCCTGTGGCCTTTGGTTGG - Intergenic
1038433196 8:27516133-27516155 GGGCTGCTGTGGACGGTGGTGGG - Intronic
1040493219 8:47943848-47943870 GATATGCTGTGCCCTCAGGTAGG - Exonic
1047152549 8:122280704-122280726 GGGATTCTGTGGGCTCTTTTTGG - Intergenic
1048967235 8:139623989-139624011 AGGATGATGTGGCCTCTTGCGGG - Intronic
1048973219 8:139656782-139656804 GAGAGGCTGTGGCCTCTGTCCGG - Intronic
1049714409 8:144083052-144083074 CGGAGGTTGTGGCCTCGGGTCGG + Intronic
1050914712 9:11117602-11117624 GGGATTCGTTGGCCTCTGGCTGG + Intergenic
1053304967 9:36977855-36977877 CAGATGCTGTTCCCTCTGGTTGG - Intronic
1053477839 9:38394959-38394981 GGGATGCTGAGACCTGTGGTTGG + Intronic
1053810045 9:41842681-41842703 GGGATGCTCTGGCCACAGATGGG + Intergenic
1054620548 9:67344747-67344769 GGGATGCTCTGGCCACAGATGGG - Intergenic
1058045314 9:100352237-100352259 GGAAGTCTGTCGCCTCTGGTTGG - Intronic
1059520038 9:114932442-114932464 AGAAGGCTGTGTCCTCTGGTGGG + Intergenic
1060437222 9:123604339-123604361 GGGATGCTGTAGGCTCTGGGAGG - Intronic
1060508761 9:124217071-124217093 GGGATTCTCTAGCCTCTGGGTGG - Intergenic
1060818727 9:126649576-126649598 GTGATGCTGAGGCCACTGATGGG + Intronic
1060962074 9:127688114-127688136 GGGACCCTGTGGCCCCTGGGAGG - Intronic
1061076429 9:128344192-128344214 CTGATGCTGTGCCTTCTGGTTGG - Intronic
1061625707 9:131839465-131839487 GGCATGCTGTGGCCTCTGTGAGG - Intergenic
1061667627 9:132169608-132169630 GGGAGGCTGTGCCGCCTGGTGGG - Intronic
1061815140 9:133190238-133190260 GAGATGCTGTCCCCTCTGTTGGG + Intergenic
1062010793 9:134265623-134265645 GGGATCCTGTGGCCTGGGGCTGG + Intergenic
1062022161 9:134324951-134324973 GGGACGGGGTGGCCTTTGGTAGG + Intronic
1062697348 9:137882227-137882249 AGGCTGCTGTGGCCTCTGCCTGG + Intronic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1187010125 X:15270134-15270156 GGGTTCTTGTGGCCTCTGGCGGG - Exonic
1189427357 X:40913044-40913066 GGGCTCCTGTGCCCTCTGTTCGG - Intergenic
1190094228 X:47466269-47466291 TGGATGCTGTTGGCTCTGGAAGG - Intronic
1190129154 X:47730832-47730854 TGGATGCTGTCGGCTCTGGAAGG + Intergenic
1190219076 X:48499376-48499398 GGGATGCTGAGATGTCTGGTGGG + Intergenic
1190339579 X:49286189-49286211 GGGCTGCTGTGGCTGCGGGTGGG + Exonic
1191700174 X:64033617-64033639 GGGAGCCTGAGGTCTCTGGTGGG - Intergenic
1194496638 X:94624102-94624124 GGGCTCCTGTGGATTCTGGTGGG - Intergenic
1196754757 X:119148213-119148235 GGGATACTGTGGCCTCTCTCTGG - Intronic
1200147855 X:153935617-153935639 GCGATGCAGTGGCATCTGGGCGG - Intronic
1200846549 Y:7836574-7836596 TGGATCCTGTGGCCTCAGGATGG + Intergenic
1201511548 Y:14769842-14769864 GGGATGCTGTGGCTTGGTGTGGG + Intronic