ID: 1148876505

View in Genome Browser
Species Human (GRCh38)
Location 17:50690446-50690468
Sequence CTGGAGAAGTGCTCCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148876505_1148876517 17 Left 1148876505 17:50690446-50690468 CCCATGGAGGAGCACTTCTCCAG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1148876517 17:50690486-50690508 CCCCTCCTGCCGTACCCTGGTGG 0: 1
1: 0
2: 0
3: 17
4: 145
1148876505_1148876515 14 Left 1148876505 17:50690446-50690468 CCCATGGAGGAGCACTTCTCCAG 0: 1
1: 0
2: 0
3: 15
4: 126
Right 1148876515 17:50690483-50690505 CTTCCCCTCCTGCCGTACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148876505 Original CRISPR CTGGAGAAGTGCTCCTCCAT GGG (reversed) Intronic
902055048 1:13593780-13593802 CTGGAGCAGAGCTTCTCAATGGG - Intronic
902990532 1:20184605-20184627 AAGGTGAATTGCTCCTCCATGGG - Intergenic
903910721 1:26723009-26723031 CTGGACAATTTCTCCTCAATTGG + Intronic
906211365 1:44014080-44014102 CTGGAGCAGAGCCCATCCATGGG - Intronic
908029000 1:59980245-59980267 CTGCAGAAGAGCTCCTGCAAGGG + Intergenic
908039382 1:60091844-60091866 TTGGAGAATTGCTCCTCCACTGG + Intergenic
908724321 1:67158413-67158435 GTGGAGAAGGGCTATTCCATAGG + Intronic
915065114 1:153218460-153218482 CAGGAGAAGTGCTCATCCCCTGG + Exonic
915666628 1:157450957-157450979 ATAAAGAAGGGCTCCTCCATAGG + Intergenic
915923065 1:159992558-159992580 CTGGATAATTCCTCCTCTATGGG + Intergenic
918778263 1:188666107-188666129 GTGGTGAAGTGTTCCTGCATTGG - Intergenic
924067463 1:240239577-240239599 CTGGACATGTCTTCCTCCATAGG + Intronic
1064037370 10:11925704-11925726 CTGGAGAACTCCTGCTCCTTCGG - Intronic
1067338562 10:45383004-45383026 CTAGAGAAGTGCCCATCCAGGGG - Intronic
1074424356 10:113338142-113338164 CTAGAGAAGTTGTACTCCATGGG + Intergenic
1076765737 10:132632024-132632046 GTGGAGATGTGCACCCCCATGGG + Intronic
1078479817 11:11665817-11665839 GTGGAGTGGTGCTACTCCATAGG - Intergenic
1081783048 11:45726793-45726815 CTGGAGCAGGGCTCTGCCATGGG + Intergenic
1082117473 11:48343099-48343121 CTGGTGATGTGCAGCTCCATGGG + Intergenic
1084772774 11:71354761-71354783 CTGGAAAAGTGCTTCTGCACAGG + Intergenic
1087129446 11:94655688-94655710 CTGGATAAGTTCCCCTCCTTTGG - Intergenic
1093642164 12:21540820-21540842 CTGGATCAGTGATCCTCCATGGG + Intronic
1094196311 12:27753404-27753426 TTGGAGATGTGTTCCTCCAAGGG - Intronic
1095928200 12:47600354-47600376 TTGGAGGAGTCCTCCTCCACTGG - Intergenic
1098373448 12:69785265-69785287 CTGGAGCAGTGTTTCTCCATAGG + Intronic
1100010126 12:89942862-89942884 GTGGAGCAGGGCTACTCCATAGG + Intergenic
1100977119 12:100134088-100134110 CTACAGTAGTCCTCCTCCATGGG - Intronic
1101574772 12:105987294-105987316 CTGGGGAAGTGCTTTTCCCTGGG - Intergenic
1101749686 12:107573183-107573205 GTGGGGAAGTCATCCTCCATGGG + Intronic
1102503349 12:113368179-113368201 GTTGAGAAGTGCTCCTTCAGAGG + Intronic
1103028197 12:117591330-117591352 CTGGAGGAGTCTTCCTCCAGGGG + Intronic
1104193652 12:126508936-126508958 CAGGAGAAGTGCTCCAGCCTAGG + Intergenic
1109135163 13:58640197-58640219 CTTGAGAATTGCTTTTCCATGGG + Intergenic
1109600655 13:64623700-64623722 TTGTACATGTGCTCCTCCATGGG - Intergenic
1122214590 14:100194391-100194413 TTGGAGAACAGCTCATCCATGGG + Intergenic
1124800304 15:32826267-32826289 CTGGAGAGCTGCTTCTCTATGGG - Intronic
1129037193 15:72657650-72657672 ATGGGGTAGTGCTCCCCCATTGG + Intronic
1129212694 15:74079576-74079598 ATGGGGTAGTGCTCCCCCATTGG - Intronic
1129397705 15:75261510-75261532 ATGGGGTAGTGCTCCCCCATTGG + Intronic
1129401316 15:75285787-75285809 ATGGGGTAGTGCTCCCCCATTGG + Intronic
1129466327 15:75726144-75726166 TTGGAGATGCGCTCCTCCATGGG - Exonic
1129729839 15:77923898-77923920 ATGGGGTAGTGCTCCCCCATTGG - Intergenic
1129838681 15:78730085-78730107 ATGGGGTAGTGCTCCCCCATTGG + Intergenic
1130148282 15:81292173-81292195 CTGGAGATGGGCTGCCCCATTGG + Intronic
1132321226 15:100927067-100927089 TTTGAGAAGTGCTGCTCTATGGG - Intronic
1133702334 16:8320624-8320646 ATGGAGACTTGCTCATCCATGGG - Intergenic
1137222818 16:46472636-46472658 CAGCATAAGTACTCCTCCATTGG + Intergenic
1142041964 16:87900093-87900115 CTGGAGCATTTCTTCTCCATGGG - Intronic
1144201214 17:12944101-12944123 ATGGTGAGGTGCTCCTCCAGCGG - Exonic
1146640325 17:34535913-34535935 CTGGAGACAGGCTTCTCCATGGG + Intergenic
1147542241 17:41370055-41370077 CTGTAGCAGTGCTTATCCATGGG + Intronic
1148251673 17:46086718-46086740 CTCAAGCAGTCCTCCTCCATTGG - Intronic
1148876505 17:50690446-50690468 CTGGAGAAGTGCTCCTCCATGGG - Intronic
1149407816 17:56372587-56372609 CTGGGGAAATGCTGCTTCATTGG - Intronic
1150306731 17:64091831-64091853 TTTGAGAAGTGCTGCTCCACAGG - Intronic
1151878301 17:76879859-76879881 CTGGAGTAGTCCTTCTCCAAAGG - Intronic
1152088922 17:78236459-78236481 CTGGCCAAGTGCTCCTCCGAAGG + Intronic
1153532959 18:6068587-6068609 TTTGAGAAGTGCTCCTCCTGTGG + Intronic
1153588753 18:6651193-6651215 CTGGAGACCAGCTCCTCCAGGGG - Intergenic
1157964312 18:52190847-52190869 CTGCAGTAGTTCTGCTCCATAGG + Intergenic
1158389675 18:57034890-57034912 CTGGAGCTGTGCTTCTCCATGGG - Exonic
1162459926 19:10808792-10808814 CTGCAGAAGTGCGCCTTCAAGGG - Intronic
1162666885 19:12220859-12220881 CTGGTTAAGTGCCCCTCCGTGGG + Intergenic
1163908065 19:20164840-20164862 CAGTAGAATTGCTCCTCTATAGG - Intergenic
1165947400 19:39452504-39452526 CTGGAGAAATGCTCCTCTCTTGG - Intronic
1166455540 19:42937189-42937211 CTTGAGAAGTGCTCCTGCCCCGG - Intronic
1166492224 19:43269544-43269566 CTTGAGAAGTGCTCCTGCCCCGG - Intergenic
1167492651 19:49801308-49801330 CTCGAGAGGTGCCCCTCCCTAGG - Intronic
925287101 2:2722889-2722911 CTGGCGGTGTGATCCTCCATTGG - Intergenic
926298118 2:11582878-11582900 ATGGAGAAGTGCTGCCCCCTGGG + Intronic
927423977 2:22960566-22960588 CTGGAGAAGTTGTCCACCCTGGG - Intergenic
934489830 2:94754722-94754744 ATGGAGAAGTGGTCCTCCCGTGG + Intergenic
934554578 2:95280570-95280592 CTGGAGTAGGTCACCTCCATGGG + Intronic
935711576 2:105903454-105903476 GTGGTGGAGTGCGCCTCCATCGG + Intergenic
939053654 2:137335336-137335358 CTGGAGATGTCCTCCTTCCTTGG - Intronic
942175351 2:173328486-173328508 CTGGAGAATTGTGCATCCATAGG - Intergenic
1169407401 20:5334008-5334030 CTGAAGAAGTGCTCGTACATTGG - Intergenic
1169689974 20:8319727-8319749 CTAGAGTAATGCACCTCCATGGG - Intronic
1169914652 20:10673432-10673454 CCGGAGAAGGGCTCCTACCTTGG + Exonic
1170396763 20:15934164-15934186 CTTCAGAAGTGCCCCTCCATGGG - Intronic
1172130165 20:32650130-32650152 CTGGAGAATGGCTTCTCCCTTGG - Intergenic
1172323573 20:34016941-34016963 CTGGAGCAGTGCTCCTAGGTAGG + Intronic
1173862301 20:46292024-46292046 CTGGAGCAGTCATTCTCCATTGG - Intronic
1174606717 20:51767299-51767321 CTGGAGATGTGCAGCTCCACAGG - Intronic
1176201615 20:63863336-63863358 CAGGTGAAGGGCTCCTCCCTGGG - Intergenic
1183073807 22:35413963-35413985 GTGGAGAAGTGTTCTCCCATTGG + Exonic
950562988 3:13746547-13746569 CTGGAGAAATGCTCCCCCCAGGG - Intergenic
955887412 3:63615323-63615345 CTGCTGGAGTGCTTCTCCATTGG - Exonic
956454863 3:69410523-69410545 CTGGAAAAGTGCTCCACCTAGGG + Intronic
962269917 3:133969976-133969998 CTGGAGCAGGGCGCCTCCCTTGG - Intronic
962912965 3:139871735-139871757 TTGGAGAAGTGGGCCTGCATGGG - Intergenic
963541914 3:146602199-146602221 CTTGAGAATGGCTCCTCAATAGG + Intronic
963894648 3:150672676-150672698 GTGGAGCAGGGCTACTCCATAGG + Intronic
964291201 3:155182742-155182764 CTGGAGAGTTGTTCCTCCATAGG - Exonic
964401221 3:156301022-156301044 CTGGAGTTGAGCCCCTCCATGGG - Intronic
964479978 3:157130492-157130514 CTGCTGTAGTGCTCCTCCCTCGG - Intergenic
968567659 4:1322677-1322699 CTGGAAAAGTGCACCTCATTTGG + Intronic
969681908 4:8647824-8647846 CTGGAGAAGTGCCTTTTCATGGG + Intergenic
970226992 4:13869537-13869559 CTAGAGAAGTACTCCTACATGGG - Intergenic
970309073 4:14762682-14762704 CTGGAGAATTAATGCTCCATGGG - Intergenic
976407829 4:84679574-84679596 CTGCAGACCTGCTCCTCCAAAGG + Intronic
977562306 4:98544948-98544970 ATGGAGGAGGGCTGCTCCATGGG - Intronic
987225374 5:15834602-15834624 CTGGAGAGCTTCTCCTCTATCGG - Intronic
992780063 5:80119643-80119665 CTGGAAAAGTCCTCCTCTCTGGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
997467694 5:134099289-134099311 CTGCAGAACTGCTCTTCAATGGG + Intergenic
997670355 5:135666282-135666304 ATGGAGAAGTTCTCCTCTAGTGG - Intergenic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
1000491124 5:161914959-161914981 ATGGAGAACTGCTCCTCAGTGGG + Intergenic
1000535574 5:162473881-162473903 ATGCAGAATTGCTCCTCTATAGG + Intergenic
1001286124 5:170425399-170425421 CTGGAGAAAGACTCCTGCATGGG - Intronic
1001770615 5:174293279-174293301 CGGGAGCAGGGCTCCTCCCTAGG + Intergenic
1002128176 5:177062440-177062462 CTGGGGAAGTGCTTTTCCACTGG + Intronic
1002191702 5:177481668-177481690 CTGGAGAAGGGCTCCAGCTTAGG - Intergenic
1003356216 6:5373777-5373799 CTTGAGAAGCGCTGCTCTATGGG + Intronic
1006461638 6:34162542-34162564 CTGGACAAGTTCTCCTCCTTGGG - Intergenic
1007770000 6:44184617-44184639 CCGTAGAAGCGCTCCACCATAGG - Intergenic
1009625642 6:66136771-66136793 CTGGAGAAGTGCTCCAGCACAGG - Intergenic
1012839684 6:104314227-104314249 CTGGAGAGGTACTGCTCCAGAGG + Intergenic
1014825416 6:126044511-126044533 ATGGAGAATTGCTTCTCAATTGG - Intergenic
1016797532 6:148133732-148133754 CAGGAGAATTGCTCGACCATGGG + Intergenic
1019947545 7:4342029-4342051 CTGGAGCAGTGGTTCTCCACAGG + Intergenic
1020354573 7:7262561-7262583 CTGATGAAGTGCTACTCCTTAGG - Intergenic
1023579840 7:41670039-41670061 CTGGGGAAGTCATCCTCCACAGG - Intergenic
1024619997 7:51148834-51148856 CTGGAGCAGTGGTCCTCCGGGGG - Intronic
1035759018 8:2055697-2055719 CTGGGGAAGCGCTGGTCCATCGG + Intronic
1036747512 8:11420362-11420384 CTGGAGAAGAGCTCTTCCAGTGG - Intronic
1044537310 8:93372030-93372052 CTGGTGAAGAGCTCAGCCATTGG - Intergenic
1045457179 8:102392269-102392291 ATGGAGAATGGCTACTCCATAGG - Intronic
1048371065 8:133776588-133776610 CTGGGGAAGTCCTCCACCTTTGG + Intergenic
1049193123 8:141299888-141299910 CTGGAAAGGGGATCCTCCATTGG - Intronic
1050447042 9:5735413-5735435 CAGAAGAAGTACTCCTCCCTAGG + Intronic
1050827502 9:9967057-9967079 CTGGTGAAGTTCTCAGCCATTGG - Intronic
1053423399 9:37995481-37995503 CTGGAAAAATGCTCCTCCACAGG + Intronic
1056657513 9:88521478-88521500 CTGGAGAAGTGCCCCCACAGAGG + Intergenic
1187861612 X:23688919-23688941 CTGGAGCAGTGCTTCTCAATGGG + Intergenic
1188078921 X:25812552-25812574 CTATAGAACTGCTCCTCTATTGG + Intergenic
1192582672 X:72298148-72298170 CAGGAGCAGTGCTGCTCCCTAGG - Intronic
1197696440 X:129555017-129555039 TAGGAGAAGTGCTCCTCCTAGGG + Intronic
1198263292 X:134985843-134985865 CTGGAAAAGTGCTTTTGCATTGG - Intergenic
1200024827 X:153249058-153249080 TTGGAGTAGTGCTTCTCCCTGGG - Intergenic
1200126721 X:153818804-153818826 CTTGCGAATTGCTCTTCCATCGG - Intronic