ID: 1148876613

View in Genome Browser
Species Human (GRCh38)
Location 17:50691064-50691086
Sequence CAAAAAAGAGAGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 736
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 669}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148876613_1148876618 -4 Left 1148876613 17:50691064-50691086 CCTGACCACTTCTCTCTTTTTTG 0: 1
1: 0
2: 3
3: 63
4: 669
Right 1148876618 17:50691083-50691105 TTTGACTAGGGTCCTGGTCCTGG 0: 1
1: 0
2: 1
3: 3
4: 95
1148876613_1148876619 3 Left 1148876613 17:50691064-50691086 CCTGACCACTTCTCTCTTTTTTG 0: 1
1: 0
2: 3
3: 63
4: 669
Right 1148876619 17:50691090-50691112 AGGGTCCTGGTCCTGGACAAAGG 0: 1
1: 0
2: 2
3: 14
4: 176
1148876613_1148876617 -10 Left 1148876613 17:50691064-50691086 CCTGACCACTTCTCTCTTTTTTG 0: 1
1: 0
2: 3
3: 63
4: 669
Right 1148876617 17:50691077-50691099 CTCTTTTTTGACTAGGGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148876613 Original CRISPR CAAAAAAGAGAGAAGTGGTC AGG (reversed) Intronic
901464286 1:9411326-9411348 AAGAAAAGAGAGAGGTGGGCAGG - Intergenic
901484737 1:9550971-9550993 TTAAAAAGATAGAAGTGGCCAGG - Intronic
901697377 1:11018482-11018504 TAAAAAAGAGAGATGGGGCCAGG - Intronic
901868440 1:12123385-12123407 CCAAACAGAGAGAAGGGGTGGGG - Intronic
902200677 1:14831153-14831175 CAAAAACAAGAGAATTGGGCAGG - Intronic
903535285 1:24062755-24062777 CAAAGAAGAGCCAAGTGGTCAGG - Intronic
903842322 1:26252234-26252256 CAAAAAAGAAAAAATTGGGCCGG + Intronic
903928327 1:26847840-26847862 ATAAAAAGAGAGAGGAGGTCGGG - Intronic
904145341 1:28386387-28386409 CAAAAACAACAGAATTGGTCAGG - Intronic
904562414 1:31407501-31407523 AAAAAAAAAAAGAAGTGGCCTGG - Intergenic
904562471 1:31407813-31407835 CTTAAAAGACAGAAGTGGTCTGG - Intergenic
904881437 1:33700300-33700322 TAAAAAGGAGTGAAGTGGCCGGG - Intronic
904895815 1:33817279-33817301 GAAAAAAGAGAGAAGAAGGCAGG + Intronic
906287800 1:44598955-44598977 AAAAAAAGAGAGATGGGGTGGGG - Intronic
906335294 1:44924679-44924701 CAAAAAAAAGAGGATTGGCCAGG - Intronic
907077245 1:51590047-51590069 AAAAAAAGAGAGAGGTAGGCAGG + Intronic
907358460 1:53895509-53895531 CAAAAAAGAGAAAACTGGAACGG - Intronic
907721137 1:56973459-56973481 CAAAAAAAAGAGAAGAAGTTTGG - Intergenic
907748587 1:57239782-57239804 CAGAAAAGAGAGAATTTATCTGG - Intronic
908203801 1:61824359-61824381 CAAAAAAAAAAAAAGTGGACCGG - Intronic
910165642 1:84324945-84324967 TAATAAAATGAGAAGTGGTCCGG + Intronic
910444345 1:87285243-87285265 CATAGAAGATAGAAGTGGACTGG - Intergenic
911108358 1:94156400-94156422 TAAAAAAGAGGCAAGTGGTGAGG + Intronic
911806266 1:102211698-102211720 CTAAAAAGAGAGAAGTTGGCTGG - Intergenic
912842619 1:113052206-113052228 CAAAAAAGAAAAAAGGGGACGGG + Intergenic
913369796 1:118085443-118085465 GATAAAAGAGTGCAGTGGTCAGG + Intronic
913458150 1:119055315-119055337 AAAAAATCTGAGAAGTGGTCAGG + Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914761781 1:150605052-150605074 CAAAAAAAAGAGATGAGGTGAGG - Intronic
914987633 1:152474035-152474057 CCAGAAAGAGAGTTGTGGTCAGG - Intergenic
915064096 1:153210498-153210520 CAAACAAGAGAGGATTGCTCTGG + Intergenic
915170577 1:153974400-153974422 AAAACAAGGGAGAAGTGGTGGGG + Exonic
915414277 1:155728563-155728585 AAAAAAAGATAAAAGAGGTCAGG + Intronic
915432876 1:155880192-155880214 AAAAAAAAAGAGAAATAGTCAGG + Intronic
915601669 1:156926570-156926592 CAAAAAAAAAAGAAGAGGTGGGG - Intronic
915651226 1:157312332-157312354 CAAAAATGAGATTAGAGGTCTGG - Intergenic
916048213 1:161016656-161016678 CAAAAAAAAAAAAAGTGATCTGG + Intronic
916662403 1:166934832-166934854 CAAAGAAGAAAGAACTGGACTGG - Intronic
917015650 1:170528690-170528712 TAAAAAACATAGAAGTGGGCGGG + Intergenic
917223833 1:172760701-172760723 AAAGAAAGAGAGAAGTGGGTAGG + Intergenic
917696457 1:177529931-177529953 CAAAAAAGAGAAATTTAGTCAGG - Intergenic
917753393 1:178075284-178075306 GGAAGAAGAGAGAAGTGGTAAGG + Intergenic
917916287 1:179705631-179705653 TAAAAAAGAGAAATGTGGCCAGG - Intergenic
918507720 1:185275313-185275335 TAAAGAAGAAAGAAGTGGACTGG + Intronic
918562347 1:185884513-185884535 CAAAAAAGTGAGATGAGTTCAGG - Intronic
918622844 1:186624912-186624934 CAGAAATGAGAGATGTGATCAGG + Intergenic
919513362 1:198493666-198493688 CAAGAAGGAGAGAAGTGCTGCGG - Intergenic
919775826 1:201193356-201193378 CAGAGAGGAGAGAAGTGGTAGGG + Intronic
920422013 1:205841279-205841301 CAAAAAAGCACTAAGTGGTCAGG + Intronic
921315026 1:213882284-213882306 AGCAAACGAGAGAAGTGGTCTGG - Intergenic
922181245 1:223234580-223234602 CCAACAGGAGAGAAGTGGACAGG - Intronic
922409409 1:225356458-225356480 CAAAAATTAGAGAAGTGGGTTGG - Intronic
922424368 1:225479923-225479945 AAAAAAAAAAAGAAGTGGCCAGG + Intergenic
922487132 1:225982274-225982296 TAAAAAAGAGAAAACTGGCCAGG + Intergenic
922631127 1:227112658-227112680 CAAAAAAGAGGTTAGTAGTCAGG - Exonic
922793742 1:228326525-228326547 AAAAAAAGAGAGAAATTGTTGGG - Intronic
922815244 1:228444498-228444520 AAAAAAAGAGAACAGTGGCCGGG + Intergenic
923156773 1:231285984-231286006 CAAAAAAAAAAGAAGTGGGATGG + Intergenic
923386386 1:233469347-233469369 CAAAAAAGAGAGACATGGAGTGG + Intergenic
924006659 1:239619208-239619230 TAAAAAAGAGAAAGGAGGTCAGG - Intronic
924023953 1:239813568-239813590 CAAAATAGAGAGAAGACTTCAGG + Intronic
924069484 1:240261698-240261720 CAGAGAGGAGAGAAGAGGTCAGG + Intronic
924319041 1:242828790-242828812 CAAAAAAGAGAAAAGATGTTTGG + Intergenic
1063352985 10:5373686-5373708 CAGAAAAGAGGGATGTGGGCAGG - Intronic
1063399603 10:5729807-5729829 AAAAAAAAAGAGAAAAGGTCTGG - Intronic
1064341956 10:14494878-14494900 CAAAAAAGACAAAAGTAGCCAGG + Intergenic
1064440666 10:15350634-15350656 AAAAAAAGAGAGAATTGGCTGGG - Intronic
1064545294 10:16444286-16444308 CAAAAAAAAGAAAAGAGGCCGGG - Intronic
1064585454 10:16835064-16835086 GAAAAAAGAGGGAAATGGTGTGG + Exonic
1064683945 10:17839761-17839783 CAAAAAAGATAGAGGTGGCAGGG + Intronic
1065313016 10:24434332-24434354 AAAAAAAGAGAGATGAGGCCAGG - Intronic
1065820519 10:29520926-29520948 AAAAAAAGAAAGAAGGGGCCAGG + Intronic
1066413115 10:35192921-35192943 CAAAAGAGGGAGAAGTGGAGAGG - Intronic
1066619923 10:37336791-37336813 CAAAAAAAAGAGACATGATCAGG - Intronic
1068222656 10:54063911-54063933 CAAAAAGGAGAGAAGAGTTGCGG - Intronic
1070093777 10:73315725-73315747 CAAAAAATAAAAAAGTTGTCTGG - Intronic
1070382822 10:75896744-75896766 CAAGTAAGAGAGAAGTGGGGCGG - Intronic
1070398130 10:76030853-76030875 GAGAAAAGAGAGAATTGGTGAGG - Intronic
1070491296 10:76979321-76979343 CAGAAAAGAGAGCTGGGGTCAGG + Intronic
1070684862 10:78472799-78472821 CAAAAAAGAGAGTGGGGGTGGGG - Intergenic
1071140244 10:82501220-82501242 CAAGTAAGAAAGAAGTGGACTGG + Intronic
1071385727 10:85119317-85119339 CAAAAAGGAGAGAAGTGGGCTGG - Intergenic
1071469457 10:85972145-85972167 AAAAAAAAAGAAAAATGGTCAGG - Intronic
1072161421 10:92770844-92770866 TAAAAAAGGGAGATGGGGTCAGG + Intergenic
1072887152 10:99287908-99287930 CAAAAAAGAAAGAAATGTTGTGG + Intergenic
1073171486 10:101512809-101512831 CAAGAAAGAAAGAAGCTGTCAGG - Intronic
1073246794 10:102096515-102096537 CAGAAAAGAGAGAAAGGGCCGGG - Intergenic
1073263677 10:102209774-102209796 AAAAAGAGAGAGGAGAGGTCAGG - Intergenic
1073754064 10:106562023-106562045 AAAAAAAGAGAGAAGAGGAAGGG + Intergenic
1073769123 10:106716044-106716066 ATAAAAAGAAAGAAGTGGCCGGG - Intronic
1073806932 10:107108438-107108460 CAAACAAGAGAGTAGTGGTGAGG + Intronic
1073950405 10:108802117-108802139 CAAAAAAGAGTAAATTGGTCTGG + Intergenic
1074945704 10:118278643-118278665 CAAAAAAGAGAGATCTGCTGAGG + Intergenic
1075566757 10:123510645-123510667 CAGAAGGGAGAGAGGTGGTCTGG - Intergenic
1076105911 10:127823558-127823580 CAAACAAGAGAAAAGGGGTCTGG + Intergenic
1080135004 11:28844449-28844471 GAAAAAAGAGAAAAGTGGGAGGG - Intergenic
1080299869 11:30772058-30772080 CAAAAAAGGGGGCAGAGGTCGGG - Intergenic
1081010924 11:37811841-37811863 CAAGAAAGAGAGAAGAGCTGTGG - Intergenic
1081146322 11:39565376-39565398 AAAAAGAGATAGAAGTGGTAAGG + Intergenic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1082041791 11:47691996-47692018 CAAAAAAGAAAGAGGTGATGGGG - Intronic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082825494 11:57574850-57574872 TAAAAATGAGAGAACTGGTCAGG + Intergenic
1083077662 11:60057698-60057720 AAAAAATCAGAGAAATGGTCCGG - Intronic
1083236504 11:61354192-61354214 TTAAAAAGGGAGGAGTGGTCAGG + Intronic
1083247635 11:61441872-61441894 AAAAAAAGGGAGGAGTGGTGGGG - Intronic
1083464007 11:62833315-62833337 AAAAAAAAAGAAAAGTAGTCAGG + Intronic
1083534179 11:63453625-63453647 AAACATGGAGAGAAGTGGTCAGG - Intergenic
1083777001 11:64898906-64898928 AAAAGAATAGAGAAGGGGTCTGG - Intronic
1083866967 11:65460512-65460534 CTAAAAACACAGAAATGGTCTGG - Intergenic
1084297241 11:68220781-68220803 CAAAAAAGAGGGAAATAATCTGG + Intergenic
1084597514 11:70125854-70125876 AAAAAAAGAGAGAAGAGGGGAGG + Intronic
1084879648 11:72161371-72161393 CAAAAAAGAAATCAGTGGGCTGG - Intergenic
1085948612 11:81302719-81302741 CAAACAAGAGTGATGAGGTCTGG + Intergenic
1088392863 11:109334703-109334725 ATAAAAAGAGGGAATTGGTCAGG + Intergenic
1088874967 11:113927853-113927875 CAAAAAAGAGAAAACAGGGCCGG - Intronic
1089834791 11:121360351-121360373 AAAAAGAGAGAGAAGTGGCTGGG - Intergenic
1089877838 11:121742737-121742759 CAAAAAAGAGAGAGCTGTACTGG - Intergenic
1090698333 11:129271286-129271308 GAAAAAAGTGAGATGTAGTCAGG + Intronic
1091163217 11:133445415-133445437 CACAGAAGAGAAAATTGGTCTGG - Intronic
1091491879 12:939769-939791 CAAAGAAGAGAGAAGAGGGCTGG + Intronic
1091870463 12:3885991-3886013 AAAACCAGAGATAAGTGGTCAGG + Intergenic
1092366406 12:7880708-7880730 AAAAAAAGAGAGAAATTGGCCGG + Intronic
1095451646 12:42337589-42337611 CAAAAAAAAGAAAAGAGGCCAGG - Intronic
1095824726 12:46519295-46519317 CAAAAGAGAGAGAAGAGGAGAGG - Intergenic
1096122999 12:49100721-49100743 AAAAAAAAAAAGAAGTGGGCTGG - Intronic
1096336414 12:50760091-50760113 TAGAAAAGAGAGATGTGGCCAGG - Intergenic
1096396075 12:51267784-51267806 GATAAAAGAGAGAAATGGCCAGG - Intronic
1096744236 12:53715128-53715150 CAAGACAGAGAGAAGGGGTATGG + Intronic
1097380145 12:58885217-58885239 CAAAAAAGAGAACAATGGTAAGG + Intronic
1097500317 12:60393006-60393028 CAAGAAAGAGAGAAGAGATAAGG + Intergenic
1097777182 12:63661597-63661619 CAAAATAGCGAGAAGTGATTAGG - Intronic
1098671362 12:73234873-73234895 CAAGAAAGAGAGAAGAGCTACGG - Intergenic
1100447511 12:94675223-94675245 AAAAAAAGCCAGCAGTGGTCTGG - Intergenic
1100497832 12:95142437-95142459 CAAAAAATAGAAAAATGGGCTGG - Intronic
1100512130 12:95285971-95285993 AAAAAAAAAAAGAAGGGGTCGGG - Intronic
1100717459 12:97321125-97321147 TAAAAAAGAGAAAAGAGGCCGGG - Intergenic
1101368484 12:104100414-104100436 CAAAAAATAAAGAAGTTTTCTGG + Intronic
1101640944 12:106585370-106585392 CAAAAGGGAGAGAAGTGGATGGG - Intronic
1102629351 12:114263723-114263745 ATATAAAGTGAGAAGTGGTCAGG + Intergenic
1103319769 12:120085288-120085310 CAAAAAAAAAAGAAGTAGCCAGG + Intronic
1103328735 12:120139012-120139034 AAAAAAGGAGAGAAGGGGCCGGG + Intronic
1103419631 12:120770044-120770066 CAAAAAAAATAAAAGTGGTGGGG - Intronic
1103829059 12:123763858-123763880 AAAAAAAAAAAGAAGTGGCCAGG - Intronic
1104001961 12:124865555-124865577 AAAAAGGGAGAGAAGTGGGCTGG + Intronic
1104041666 12:125134771-125134793 CTGGAAAGAGAGAAGAGGTCAGG - Intronic
1104224578 12:126819222-126819244 AAAAAAAGAGAGACTTGGTGTGG + Intergenic
1104299648 12:127552635-127552657 AAAAAAAAAGCAAAGTGGTCAGG - Intergenic
1104389994 12:128384079-128384101 CAAAACAAAAAGAGGTGGTCAGG + Intronic
1104952743 12:132449392-132449414 TTAAAAAGAGAGAAGTGCTTAGG + Intergenic
1105017568 12:132795194-132795216 AAAAAAAGAAAAAAGGGGTCGGG + Intronic
1107138372 13:36970316-36970338 TAAAAAAAAGAGAAGAGGCCAGG + Intronic
1107213704 13:37889783-37889805 CAAAAAAGAGAAGAGTGGTTTGG + Intergenic
1107410097 13:40150561-40150583 AAAAAAAGAGAGGGGAGGTCAGG - Intergenic
1107490242 13:40874482-40874504 CAAAAATGAGATAAATAGTCAGG - Intergenic
1107796788 13:44061250-44061272 CAAAGAACAAAGAAGTGGGCAGG + Intergenic
1108108857 13:47045848-47045870 CAAAAAAGAAATGAGGGGTCAGG + Intergenic
1108146518 13:47483278-47483300 GAAAGAAGAGAGAAGTGGGGTGG + Intergenic
1108841061 13:54615575-54615597 AAAAAAAGAGTTAAGTGTTCTGG - Intergenic
1109535749 13:63717009-63717031 TAGAAAAGAGAGTAGTGTTCAGG + Intergenic
1109540352 13:63769277-63769299 TAGAAAAGAGAGTAGTGTTCAGG - Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1109903793 13:68810588-68810610 TAAAAGAGAGATAAGTGGGCAGG - Intergenic
1111242087 13:85487368-85487390 CAAAATTGAGAGAACTGGTCTGG - Intergenic
1111731960 13:92087754-92087776 AAAATAAGAGAGAAGTGGGAAGG - Intronic
1112010196 13:95287291-95287313 CCAAAAAAAGAGAACTGGCCAGG + Intronic
1112010686 13:95291363-95291385 AAAAAAAGACAGAAGTGCCCAGG + Intronic
1112096065 13:96133419-96133441 CAAAAAAAAGATAATAGGTCAGG - Intronic
1112358083 13:98691332-98691354 TAAAAAAGAATGAAGTGGCCGGG - Intronic
1114349498 14:21835082-21835104 AAAAAAGGAGAGAAGTGCTGTGG - Intergenic
1114465783 14:22921582-22921604 CAAAAAAGAGAGATAAGATCAGG + Intronic
1115495373 14:33999199-33999221 CAAAAAGGAATGAAGTGGCCAGG + Intronic
1115895680 14:38084382-38084404 CAAAAGAGAGGGAAGGGGCCAGG - Intergenic
1115955259 14:38771362-38771384 CAATAAAGATAGTAGTGGTGGGG - Intergenic
1116356822 14:43939752-43939774 CAAAAAAGAAAGAAGAGCTGCGG + Intergenic
1116530323 14:45964808-45964830 CAAAAAAGAGAAAAATTATCTGG - Intergenic
1116841564 14:49823652-49823674 GAAAAAAGAAAGCAGAGGTCAGG + Intronic
1117503591 14:56378406-56378428 CAACAAGGAGACAAGAGGTCTGG + Intergenic
1117813302 14:59571034-59571056 AACAAAAGAGAGAAGGGGCCAGG - Intronic
1117976956 14:61308548-61308570 CAAGAAAGACACAAGTGCTCTGG - Intronic
1118267955 14:64313592-64313614 GAAAAAAGAAAGAAGAGGCCAGG + Intronic
1119517701 14:75261346-75261368 AAAAAAAGAAAGAACTGGCCAGG - Intronic
1120343750 14:83256263-83256285 GAAAAAAGACAGAATTGATCAGG - Intergenic
1120475976 14:84987712-84987734 CAAAAAAGGGAGAAGTCATATGG - Intergenic
1120808966 14:88782916-88782938 CAAAAAATACAGAATTAGTCAGG + Intronic
1120896704 14:89539134-89539156 TAAAAAAAAGAAAAGTGGCCAGG - Intronic
1120954890 14:90073202-90073224 CTAAGAAGACAGAAGTGGTCTGG + Intronic
1121073730 14:91049316-91049338 AAAAAAAGAGACAAGTCGGCCGG + Intronic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1122087394 14:99317251-99317273 CAAACCAGAGAGGAGTGGACTGG + Intergenic
1122514811 14:102299876-102299898 ATAAAAAGAGAAAAGTGGCCAGG - Intronic
1122559598 14:102602700-102602722 AAAAAAAGAAAGAAGAGGCCAGG - Intronic
1124115166 15:26834642-26834664 CAAGAAAGTGACAAGTGGCCAGG - Intronic
1124936391 15:34176077-34176099 CAAAAAGGAATGAAGTGGCCAGG + Intronic
1124998303 15:34745610-34745632 CAAAGAAGAGAGAAGTGGGTAGG - Intergenic
1125284377 15:38076117-38076139 CAAAAAAGAGAGAAGTTGATCGG - Intergenic
1125991629 15:44114820-44114842 CAATAAAGAGAAAAGTAGACTGG + Intronic
1126803236 15:52319730-52319752 CAAAAAAGAAAAAAATGATCTGG + Intronic
1126847223 15:52772097-52772119 AAAAAAAGCGAGATGTGGCCGGG + Intronic
1126906388 15:53372274-53372296 AAAGAAAGAGAGATGGGGTCGGG - Intergenic
1127146808 15:56033265-56033287 CAAAAAAAAAAAAAGTGTTCAGG - Intergenic
1127236567 15:57059388-57059410 CAAGAATGAGAGAAATGGTTAGG - Intronic
1127586918 15:60387251-60387273 TCAAGAAGAGAGTAGTGGTCTGG - Intronic
1127644284 15:60944562-60944584 CAAAAAAGAAAAAAATGGCCAGG + Intronic
1128048377 15:64640170-64640192 AAAAAAAGAGAGAGGAGGCCAGG - Intronic
1128616174 15:69111727-69111749 CAAAAAAAAGAGAGGAGATCAGG + Intergenic
1128884311 15:71272417-71272439 AAAAAAAGAAAGAAGTGGGGAGG + Intronic
1129450109 15:75646973-75646995 CAGCAAGGAGAGAAGTGGTCAGG - Intronic
1129605420 15:77022722-77022744 CAAGAAAGGGAGGAGTGTTCTGG + Intronic
1130050480 15:80479943-80479965 GAAAGAAGAGACAAGTGGGCAGG + Intronic
1130220331 15:82014128-82014150 TTAAAAAGAAAGAAGAGGTCGGG + Intergenic
1130302633 15:82691733-82691755 CTGAAAGGAGAGAAGTGGTGTGG + Intronic
1130310303 15:82747407-82747429 CAAAAAAGAAAGAAGGGGGGCGG + Intergenic
1131180451 15:90235561-90235583 AAAAAAAGAGAAAAATGATCAGG - Intronic
1131419774 15:92295621-92295643 CAAAAAAGAAAGAAAGGGCCGGG + Intergenic
1132631201 16:918517-918539 CAAAAGACAAAGAAATGGTCAGG - Intronic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1134181200 16:12049145-12049167 CAGGAAAGAGAGGAGTTGTCAGG + Intronic
1134602164 16:15542051-15542073 AAAAAAAAAGACAGGTGGTCGGG - Intronic
1134661630 16:15988731-15988753 CTAAAAAGAAAGCAGAGGTCAGG - Intronic
1135199932 16:20428532-20428554 CAAAAGAGGGAGAACAGGTCAGG - Intronic
1135307939 16:21382900-21382922 CAGGAAAGAGAGGAGTTGTCAGG + Intergenic
1135473161 16:22750275-22750297 CAAAAATGAGTGAAGTGGGCAGG + Intergenic
1135696527 16:24592514-24592536 CAAAAAACAAAAAAGTAGTCAGG - Intergenic
1135746193 16:25018591-25018613 CAAAAAAGACTGAAGAGGCCAGG + Intergenic
1136304684 16:29362020-29362042 CAGGAAAGAGAGGAGTTGTCAGG + Intergenic
1136469603 16:30470835-30470857 CAAAAAATAAAAAAGTAGTCAGG + Intergenic
1136571876 16:31102992-31103014 AAAAAAAGAGAGAAGTTGGTTGG + Intergenic
1136588040 16:31200508-31200530 AAAAAAAGAAAAAAGTGGCCGGG + Intergenic
1137284516 16:47003978-47004000 AAAAAAAGAGAGATTTGGCCAGG + Intergenic
1137687439 16:50396239-50396261 CAAAAAAGGAAGCAGTGGGCAGG + Intergenic
1138023683 16:53505651-53505673 CAAGAGAGAGAGCAGTGGTCAGG - Intergenic
1138208415 16:55142472-55142494 CAAAACAGAGAGCAGTGTGCAGG - Intergenic
1138318840 16:56093777-56093799 TCAAAAAGAGAGCAGTGGGCTGG + Intergenic
1138600921 16:58053543-58053565 CAAAAAAGCCAGAAATGGCCGGG + Intergenic
1138726252 16:59142562-59142584 CACAAGAGAGAGAAGTGGGGAGG - Intergenic
1138950912 16:61911629-61911651 AAAAAGAGAGAGAGGTGGTGGGG - Intronic
1138980136 16:62258052-62258074 AAAAAATGAAAGCAGTGGTCAGG + Intergenic
1138980254 16:62259231-62259253 AAAAAATGAAAGCAGTGGTCAGG - Intergenic
1138995686 16:62449939-62449961 CATCAAAGAGAGAAGAGGCCAGG - Intergenic
1139492224 16:67292350-67292372 CAATGAAGAGAGGAGTGGCCAGG - Intronic
1139685178 16:68597761-68597783 AAAAAAAGAAAGAAATGGCCAGG - Intergenic
1139768719 16:69255026-69255048 CAATAAAGACAGAAATGGCCTGG - Intronic
1140348348 16:74236806-74236828 AAAAACAGAGGGAAGAGGTCAGG + Intergenic
1140401228 16:74673511-74673533 GACAAAAGAGAGAAGGGGCCGGG - Intronic
1140850197 16:78928190-78928212 AAAAAAAAAGAAAAGTGGTAGGG - Intronic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141750433 16:85954678-85954700 GAAAAGAGAGAGAAGGGGACAGG - Intergenic
1142301491 16:89261150-89261172 CAAAAAAAAGAAAAGTCGGCCGG + Intergenic
1142816488 17:2430102-2430124 AAAAAAAGTGGGAAGTGGGCAGG - Intronic
1142886358 17:2914783-2914805 AAAAAAAAAAAGAAGTGGCCGGG - Intronic
1142895399 17:2974044-2974066 AAAAAAAGAAAGAAGGGGCCGGG + Intronic
1143447167 17:7016469-7016491 AAGAAAAGAGAGAAGAGGTTAGG - Intronic
1143494278 17:7302621-7302643 CAAAACAGAGAGAAATGATTCGG - Intergenic
1143558767 17:7679211-7679233 CAAACAACAGAAAAGTGGGCTGG - Intronic
1143630381 17:8136178-8136200 AAAAAAAGAGAGTAGAGGCCAGG + Intergenic
1144122709 17:12171509-12171531 CAAAACAGAAATAAGTGGTTGGG - Intergenic
1144218062 17:13074391-13074413 CAAAAAAGAGGGGAGTGGAGGGG - Intergenic
1144869665 17:18361489-18361511 CAAAAAAGAAAAAAGGGGGCTGG + Intronic
1144957759 17:19027870-19027892 AAAAAAAGGGAGAAGTGGTTTGG - Intronic
1144977398 17:19146650-19146672 AAAAAAAGGGAGAAGTGGTTTGG + Intronic
1145210295 17:21008008-21008030 CAAAAAAGACAGGAGCGGTAAGG + Intronic
1146000080 17:29125724-29125746 AAGAAATGAGAGAAGTGCTCTGG - Intronic
1146019733 17:29267229-29267251 TAAAAAATAGAGACGGGGTCTGG + Intronic
1146097919 17:29950349-29950371 AAAGAAAGAGAGAGGTGGTGGGG - Intronic
1146098618 17:29956846-29956868 AAAGAAAGAGAGAGGTGGGCTGG + Intronic
1146206858 17:30912264-30912286 TAAAAAATAGAAAAGTTGTCTGG + Intronic
1146358334 17:32154144-32154166 AAAAAAAGAGAAAAGGGGCCAGG + Intronic
1147013273 17:37469335-37469357 CAAATAAGATAAAAGTGGGCTGG + Intronic
1147251916 17:39157796-39157818 AAAAAAAGAAAAAAGTGGCCGGG + Intronic
1147337186 17:39734225-39734247 AAAAAAAAAAAGAAGGGGTCAGG - Intergenic
1147389140 17:40098889-40098911 CAAATAAGAGTGAAGTGGAAAGG + Intronic
1147665981 17:42148416-42148438 AAAAAAAAAAAGAAGTGGGCAGG + Intronic
1147721994 17:42545030-42545052 TTAAAAAGAGAGACGTGGCCGGG - Intergenic
1148003495 17:44405501-44405523 CAAAAAAAACAAAAGTGGCCGGG - Intronic
1148163216 17:45463687-45463709 AAAAAAGGAGAGAAGGGGGCCGG - Intronic
1148433508 17:47662584-47662606 AAAAAAAGAGAAAAATGGCCGGG + Intronic
1148648353 17:49231905-49231927 CAAAAAAGAGTGAGCTTGTCTGG + Intergenic
1148651065 17:49250372-49250394 CAAAATGGAGATAATTGGTCAGG + Intergenic
1148876613 17:50691064-50691086 CAAAAAAGAGAGAAGTGGTCAGG - Intronic
1148951126 17:51313549-51313571 AAAAAAAGAGAGAGATGTTCAGG + Intergenic
1149407402 17:56367777-56367799 CAAGAAAAAGAGAAGTGGATGGG + Intronic
1149457397 17:56798972-56798994 CAAGAAAGAGAGAAGGTGCCAGG + Intronic
1149462502 17:56841783-56841805 TAAAAAACAGAAAAGGGGTCAGG + Intronic
1149704593 17:58683769-58683791 AAAAAAAGAGAGACTTGGTCAGG + Intronic
1149779598 17:59386814-59386836 CAAAAAGGAGAGAATTGGTTTGG + Intronic
1150063896 17:62092456-62092478 CAAAAAATAAAGAAGTCGGCGGG + Intergenic
1151214917 17:72570873-72570895 CCAAAAAGAGACAAGTGGACCGG + Intergenic
1151307425 17:73272225-73272247 AAAGAAAGAAAGAAGTGGCCGGG + Intergenic
1151450197 17:74194129-74194151 AAAAAAAGAAAGACGTGGACAGG + Intergenic
1151738357 17:75960995-75961017 TAAATAAGAGAGAATTGGCCAGG + Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152273098 17:79336821-79336843 CAATAAAAAGTGAAGTGGGCCGG + Intronic
1153316803 18:3730476-3730498 CTAAAAAGTGAGAAGTTGACTGG - Intronic
1154211956 18:12387111-12387133 AAAAAAAAAGAAAAGAGGTCAGG + Intergenic
1157085705 18:44578613-44578635 CCAAATAGAGACAAGTGGTTAGG - Intergenic
1157766438 18:50300900-50300922 CAAAAATGAGAGAAGAGGGAAGG + Intergenic
1158961342 18:62590064-62590086 CAATAAAAAGATAAGTGGGCCGG - Intergenic
1159153857 18:64556520-64556542 CAGAAAAGAGACATGTGGGCTGG - Intergenic
1159361770 18:67414684-67414706 CAAAAAAAAAAAAAATGGTCAGG - Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160342009 18:78097399-78097421 CAAGCAAGAGAGAAGAGCTCGGG + Intergenic
1160362308 18:78294285-78294307 CACAAAAGAGAGAAGTTCACTGG + Intergenic
1160546890 18:79663947-79663969 AAAAAAAGAAAGAAGTGGGTGGG + Intergenic
1161370015 19:3905875-3905897 TAAAAAAGAGAGAGGTGGCTGGG + Intronic
1161371926 19:3917287-3917309 TAAAAAAAAGAGAAGAGGCCGGG + Intronic
1161729562 19:5951114-5951136 CAAAAAAGACACGAGGGGTCAGG - Intronic
1161739743 19:6013479-6013501 AAAAAAAGAGAGAAGAGGCCAGG - Intronic
1162557476 19:11396465-11396487 CAAAAAATAGAGAAATTGGCTGG - Intronic
1162704232 19:12543311-12543333 AAAAAAAGAGAGAAGGGGAGGGG + Intronic
1162906790 19:13828803-13828825 CAAGAAAGAGAGAAGTGGCGGGG + Intronic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163110235 19:15156027-15156049 AAAAAAAAAGAGAAGAGGCCGGG + Intergenic
1163269093 19:16239226-16239248 AAAAAAAAAGAGAACTGGCCGGG - Intronic
1163270756 19:16252136-16252158 CCAAAGAAAGAGAACTGGTCAGG - Intergenic
1163369020 19:16891756-16891778 CAAAAAAAAGAGAAGAGGAGAGG + Exonic
1163682726 19:18692607-18692629 AAAAAAAAAAAGAAGTGGTTAGG + Intronic
1163950622 19:20581350-20581372 CAAAAAAGAGTCAAATGGCCAGG - Intronic
1163967449 19:20760703-20760725 CAAAAAAGAGTCAAATGGCCAGG + Intronic
1164774297 19:30840341-30840363 CAAAAAGGAGACAAGTGTCCAGG + Intergenic
1164990380 19:32678271-32678293 CAAAAAAGAAAAAAGTGGGGGGG - Exonic
1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG + Intronic
1166042598 19:40212883-40212905 CAAAGAAGGAAGAACTGGTCGGG + Exonic
1166706651 19:44911757-44911779 CAAAAAAGAAAGAATTAGCCAGG - Intergenic
1166916773 19:46200814-46200836 CCAACAAGAATGAAGTGGTCAGG - Intergenic
1167092821 19:47356334-47356356 AAAAAAAGAAAGAATGGGTCGGG + Intronic
1167343393 19:48929876-48929898 CAAAAAAGAAAAAAGAGGGCGGG - Intergenic
1168050420 19:53825604-53825626 CAAAAAAAAGAGAATTAGCCAGG - Intergenic
1168676434 19:58281260-58281282 GGAAAAAGAGAGGAGTGGTTAGG + Intronic
925186133 2:1847618-1847640 GAAAAAAGAGCAAAGGGGTCTGG + Intronic
925636161 2:5942941-5942963 CAAAAAAGTAAGAAGGGGACAGG - Intergenic
925794172 2:7524925-7524947 ATAAAAAGACAGAAGGGGTCAGG - Intergenic
926117983 2:10225314-10225336 CAAACAACAGAGATGTGGCCGGG - Intergenic
926856500 2:17262125-17262147 CAAAAAAAAAAAAAGTGTTCTGG - Intergenic
927246549 2:20961269-20961291 CAAAAAAGAAGGAAGGGGCCGGG - Intergenic
928208110 2:29301812-29301834 CAAAAGAGAGAGAACTGGACTGG + Intronic
928931669 2:36631501-36631523 CAAAAAAGAGGAAAGTGCTATGG + Intronic
929013395 2:37470434-37470456 TAAATAAAAGAGAAGTGGTTGGG - Intergenic
929432604 2:41900855-41900877 CAAAAATGAGTAAAGTGGACTGG - Intergenic
929473085 2:42216219-42216241 AAAAAAAAAAAGAAGTGGGCCGG - Intronic
929874380 2:45784355-45784377 CAAAAAAGGAAGAAGTGGGCTGG + Intronic
930106309 2:47642668-47642690 CAAAGAAGAGAGGAGTCGGCTGG - Intergenic
930351176 2:50256820-50256842 CAAGAAAGAGGGAAATGGGCAGG - Intronic
930699479 2:54445124-54445146 AAAAAAGGAGAGAAATGGCCAGG + Intergenic
931300935 2:60977681-60977703 CAAAAATGAGAAAAGTGGGCTGG - Intronic
931359578 2:61566634-61566656 CCAAAAAGAATGATGTGGTCCGG - Intergenic
931398990 2:61913380-61913402 AAAAAAAGAGAAAAGTGGCCGGG + Intronic
932736016 2:74255244-74255266 CAACTAGGAGAGAAGTTGTCAGG - Intronic
932892014 2:75605684-75605706 AAAAACAGAGAGAAGGGCTCAGG - Intergenic
933977391 2:87522499-87522521 CAAGATAGAGAGAAATGGTGGGG - Intergenic
934750770 2:96792804-96792826 AAAAAAAAAGAGAGGAGGTCAGG + Intronic
935213208 2:100955861-100955883 CAAAAGAGAGAGAGGGTGTCAGG - Intronic
935396732 2:102618209-102618231 CTAAAAAGAGAGAAGAATTCTGG - Intergenic
935718302 2:105958123-105958145 CAAAAAAAAGAGCAGTCTTCAGG - Intergenic
936316432 2:111428306-111428328 CAAGATAGAGAGAAATGGTGGGG + Intergenic
937303977 2:120859946-120859968 CAAAAAAGGGAGTATTGGCCGGG - Intronic
937615170 2:123913491-123913513 GAAAAAAGAGAGCAGTGGAGAGG - Intergenic
937831757 2:126431932-126431954 ATAAAAATAGAGAAGGGGTCGGG + Intergenic
939438778 2:142214755-142214777 AAAAAAAGAGAGAAATAGTTAGG - Intergenic
939567918 2:143806655-143806677 CATAAAAGAGAGATGTTGACAGG + Intergenic
939590411 2:144057502-144057524 CATATGAGAGATAAGTGGTCAGG - Intronic
939749317 2:146021862-146021884 TAAAAAAGAGAGAATGTGTCAGG + Intergenic
940904864 2:159159993-159160015 CAAAAAAAAGAAAAGTGTTTTGG + Intronic
940982538 2:160019690-160019712 CAAAAAGGAGACCAGTGGTGAGG - Intronic
942096912 2:172542867-172542889 AAAGACAGAGAGAAGGGGTCGGG - Intergenic
942510601 2:176695843-176695865 CAAAAGAGAGAGAAATGGTAGGG + Intergenic
942676872 2:178435609-178435631 CAAAGTAGAGAGAAAAGGTCTGG + Intronic
943144263 2:184021495-184021517 CAAAAGAGAGAGATGTGCCCAGG - Intergenic
943308745 2:186300408-186300430 GGAAACAGAGAGAAGTGGACAGG + Intergenic
943429839 2:187785214-187785236 TAAAAAAGAGAAAAGGGGCCGGG - Intergenic
943568723 2:189546675-189546697 CAAAGAAGAGTGATGTGGTTTGG - Intergenic
943599722 2:189901099-189901121 CTAATAAGAGAAAAGGGGTCAGG - Intronic
943934003 2:193891240-193891262 CAAAAATAAGAGACGTGGTGGGG + Intergenic
944186714 2:196956847-196956869 AAAAAAAAAAAAAAGTGGTCAGG - Intergenic
944399373 2:199307802-199307824 AAAAATAGAGAGGAGTGGTGAGG - Intronic
944781619 2:203024214-203024236 AAAAAAAGAAAAAAGTAGTCAGG + Intronic
944929490 2:204501703-204501725 AAGAAAATAGAGAAGGGGTCAGG - Intergenic
945248148 2:207739523-207739545 CAAAAATGAAAGAAGTGGCCAGG - Intronic
945532207 2:210969809-210969831 GAAGAAAGAGAGAAGGGGCCGGG - Intergenic
945821563 2:214671899-214671921 GAAAGAAGAGAGGAGTGGTGAGG - Intergenic
946837487 2:223786912-223786934 CAAAAAAAAAAGAAGTGATATGG + Intronic
947672778 2:231949458-231949480 TAAAAAAGAAAGAAGTCGGCCGG - Intergenic
948360965 2:237419975-237419997 CAAAGCAGAGAGAAGTGGAGAGG + Intergenic
1169091489 20:2863764-2863786 AAAAAAAGAAAGAAGTGGCGGGG + Intronic
1169565467 20:6848997-6849019 CATCATAGAGAGAAGTGGCCTGG - Intergenic
1170711210 20:18792783-18792805 AAAAAGAGAGAAAAGTGGCCGGG - Intergenic
1170719014 20:18859084-18859106 CAAAAAAAAGAGAAGTTGCGTGG + Intergenic
1171319044 20:24222715-24222737 CAAAAAAGAGGGAAATGCTATGG + Intergenic
1171416757 20:24986727-24986749 CACAAATGAGGGAAGTGGGCAGG + Intronic
1171462371 20:25305655-25305677 AAAAAAAGAGGGAAGTAGGCTGG - Intronic
1171469927 20:25362277-25362299 CAAAAAAGAAAGAAAAGGCCGGG + Intronic
1172122612 20:32607761-32607783 CACAGAAGAGAGAAGGGGACAGG - Intronic
1172134572 20:32678378-32678400 AAAGAAAGAGAGAAGTGGCTGGG + Intergenic
1172258834 20:33543712-33543734 CACAAAGCAGAGCAGTGGTCAGG - Intronic
1172291819 20:33782304-33782326 GAAAAAAGGGAGCAGTGGTCAGG - Intronic
1172430275 20:34884901-34884923 CAAAAAAGAAAGAAATAGGCTGG + Intronic
1172877859 20:38177020-38177042 AAAAAAAAAGAGTAGGGGTCAGG + Intergenic
1173086590 20:39925167-39925189 CATAAAGGACAGAAGTGGGCGGG + Intergenic
1174234884 20:49081280-49081302 CAAAAAATAAAGAAATGGGCCGG - Intronic
1174337856 20:49876032-49876054 TAAAAATGAGACAAGTGGCCGGG - Intronic
1174381429 20:50158016-50158038 CAAAAAAGATATACGTGGCCGGG - Intergenic
1175885375 20:62287615-62287637 CAAAAAATAGAAAATTAGTCTGG - Intronic
1177151061 21:17456127-17456149 AAAGAAAGAGAGAAGGGGTGGGG + Intergenic
1177652961 21:23981601-23981623 CAAAAAAGAGGGAGGAGGCCAGG - Intergenic
1177886627 21:26754941-26754963 CAGCAAAGAGACAAGTGGTCTGG + Intergenic
1178249058 21:30984745-30984767 CAAAGAGGAGAGAAGAGGTAAGG + Intergenic
1178852701 21:36226592-36226614 CAAAAAAGAGAAAAGAGGATGGG - Intronic
1179208355 21:39304592-39304614 CAACAAAGTGAGAACTTGTCTGG + Intronic
1179246459 21:39638026-39638048 CATAAAAGTGAGAAATGGCCCGG - Intronic
1179280832 21:39932567-39932589 AAAAAAAGAGAGAATTATTCAGG + Intergenic
1181261824 22:21603545-21603567 AAAAAAAAAGACAAGTGGGCTGG + Intronic
1181389143 22:22566901-22566923 CAAAAAAGAAAGAAGAGGAGAGG - Intergenic
1181596635 22:23919346-23919368 AAAAAAAGAGAGAAAGGGGCCGG + Intergenic
1181963305 22:26638562-26638584 CAATAAAGAGACAATTTGTCAGG + Intergenic
1182100066 22:27651382-27651404 AAAAAAGGAGGGAAGTGGCCAGG + Intergenic
1182305380 22:29364404-29364426 AAAATAAAAGAGAAGGGGTCAGG - Intronic
1182312653 22:29420324-29420346 AAAAAGAGAGAGAAGGGGTCAGG - Intronic
1183008734 22:34927036-34927058 AAAAAAAGAGAAAAGTGGGAGGG + Intergenic
1183285795 22:36962780-36962802 AGAAAAAGAGAGAAGTGGAGGGG + Intergenic
1183588354 22:38766191-38766213 CAAAAAAAAGACAACTGGCCTGG + Intronic
1183903771 22:41024540-41024562 CAAAAAAGAGAGACCTGGCCGGG + Intergenic
1183907199 22:41050352-41050374 TTAAAAAGAGTGAAGTGGCCTGG - Intergenic
1184066139 22:42122666-42122688 GAAAGAACAGAGAAGAGGTCAGG - Intergenic
1184772115 22:46603502-46603524 AAAAAAAAAGAGAAGAGGCCGGG - Intronic
1184795553 22:46730420-46730442 CAAAAAAAAAAGAAGTTTTCAGG + Intronic
1185033246 22:48456890-48456912 GAAAAAAGAGAGATGAGCTCAGG + Intergenic
950046372 3:9950830-9950852 CAAAAATGAGAGACGTGGAGAGG + Intronic
950243044 3:11388721-11388743 AAAAAAAGAAAGAAGGGGCCTGG - Intronic
950341892 3:12254292-12254314 CAAAAGAAAGAGAAGAGGTGAGG + Intergenic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
950804189 3:15583623-15583645 AAAAAAAGAGAAATGTGGTAAGG - Intronic
951991534 3:28680478-28680500 CAAAAAAGAGATAACTGCTCAGG - Intergenic
952100385 3:30005135-30005157 CAACAAAGAAAGAACTGGTCCGG - Intronic
952562571 3:34612250-34612272 CTAAAGTGAGAGAAGTGGACTGG - Intergenic
952625682 3:35400018-35400040 CAAAAAAGTAAAAAGTGGTTGGG - Intergenic
952944294 3:38467149-38467171 TAAAAAAGAGACAAATGGGCTGG + Intronic
952965840 3:38620746-38620768 CCAGAAAGAGAGGGGTGGTCTGG + Intronic
954676918 3:52321093-52321115 GAAAAAAGAAAGAAATGGCCAGG - Intronic
954849399 3:53587568-53587590 CTCCAAAGAGAGAAGTGGGCTGG + Intronic
955133013 3:56189248-56189270 CTTAGAAGAGAGCAGTGGTCTGG - Intronic
955455473 3:59116533-59116555 AAAAAAAAAAAGAAGTGGACTGG - Intergenic
955476309 3:59340053-59340075 CAAGAAGAAGAGATGTGGTCTGG + Intergenic
955609293 3:60739966-60739988 CAAAGAAAAGAGAAATGTTCAGG + Intronic
955983620 3:64551183-64551205 CAAAAAAACGAGAAGTTCTCTGG - Intronic
956053715 3:65276542-65276564 CAAAGAAGGTAGCAGTGGTCAGG + Intergenic
956262612 3:67361634-67361656 CTAATAATAGAGAAGTGGGCAGG - Intronic
957373296 3:79324319-79324341 CAAATTAGAGAGAAGTTTTCTGG + Intronic
957416345 3:79910162-79910184 CAAAGAAGGAAGAAATGGTCAGG - Intergenic
958095174 3:88934861-88934883 CATAAAAGAGAGTAGAGGCCGGG - Intergenic
958429871 3:94026008-94026030 AAAAAAAAAGAGAAGTTTTCAGG - Intronic
958456559 3:94338925-94338947 CAAAAAAGAAAAAATTAGTCGGG - Intergenic
958687553 3:97419326-97419348 CAAACAAAACAGAAGGGGTCAGG + Intronic
958747695 3:98157394-98157416 CAAAATAGAGGGAAGGGCTCAGG - Intergenic
959040510 3:101417150-101417172 CAAAAAAGTCAAAAGTGGTTAGG + Intronic
959267705 3:104164923-104164945 CAAAAAATACAGGTGTGGTCTGG + Intergenic
960589473 3:119351613-119351635 AAAAAAAAAGAGAGGTGGCCTGG + Intronic
961018845 3:123487241-123487263 TAAGAAAGAGAGAAGTGGGCTGG + Intergenic
961771245 3:129251679-129251701 AAAAAAAAAGAGAAGTGGCCGGG - Intronic
961955350 3:130796405-130796427 CATACAATAGAGAAGTGGTTGGG - Intergenic
962552867 3:136513047-136513069 CAAAAAAGGGAGACTTGGGCCGG + Intronic
962724250 3:138206685-138206707 GAAAGAAGAGAGAAGAGGACTGG + Intronic
963000886 3:140680479-140680501 CAAAAAAGAAAGAAGAAGTGGGG - Intronic
963951255 3:151204645-151204667 CAAGTAAGTGAGAAGTGATCAGG + Intronic
964450587 3:156809267-156809289 CAAAAAAAAAAAAAGTGATCTGG - Intergenic
964677342 3:159298302-159298324 AAAACAAGAGAGAAGTTGTAGGG - Intronic
964875315 3:161360621-161360643 CAAAAAAGCTACAAATGGTCAGG - Intronic
964974626 3:162603934-162603956 AAAAAAAAAGAATAGTGGTCGGG - Intergenic
965759711 3:172062577-172062599 CAAGAAGGAGAAAAGTGGCCAGG - Intronic
966206463 3:177411559-177411581 ATAAAAAGACAGAATTGGTCGGG + Intergenic
966246973 3:177819490-177819512 AGAAAAAGAGAGAAGCGGCCAGG - Intergenic
966650654 3:182297138-182297160 CAAAGAAGAGAGATGCGGTTTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967612251 3:191521305-191521327 CAAAAAAGAGAGGAGAGCCCTGG - Intergenic
967615621 3:191561569-191561591 CAAAATGGAGACAAATGGTCAGG + Intergenic
967734021 3:192933380-192933402 CAAAAAATAAAAAAGTGGGCTGG - Intergenic
967974423 3:195025002-195025024 AAAAAAAGATAAAAGTGGTGAGG - Intergenic
967987625 3:195107176-195107198 CAAAAAGAAGAGAGGTGGCCGGG + Intronic
968207927 3:196821134-196821156 TAAAAAAAAGAGAAGTGGCCAGG - Intronic
968620245 4:1600640-1600662 GAAAAAGAAAAGAAGTGGTCAGG - Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968833947 4:2949195-2949217 CAAAGAAAAGAAAAATGGTCAGG - Intronic
969410752 4:7026547-7026569 CTAAAAAGTGAGAAGTGGCGTGG - Intronic
969871923 4:10110048-10110070 CAAAGAACAGAGAGGTGCTCAGG + Intronic
970747148 4:19312755-19312777 TAAAAAAAAGAAAAGTGGCCGGG + Intergenic
971253205 4:24990620-24990642 TAAATAAGACAGAAGTGGCCAGG + Intergenic
971399334 4:26261509-26261531 AAGAAGAGAGGGAAGTGGTCAGG + Intronic
971653376 4:29308944-29308966 CAAAAACGGGAGAATTGGTGGGG + Intergenic
971713286 4:30144784-30144806 CAAAAGATAGAGAAGAGGGCCGG + Intergenic
973213171 4:47638579-47638601 CAAAAAAGAGAGAGCTTGTGTGG - Intronic
973587157 4:52404951-52404973 TACAAAAGAAGGAAGTGGTCAGG - Intergenic
974013596 4:56629223-56629245 CAGAAAATAGATAAGTGGTTGGG + Intergenic
974333890 4:60514950-60514972 AAGAAAAGAGAGAAGCAGTCTGG + Intergenic
975891378 4:79032712-79032734 CAAAAAAGAGAAAAATTGGCTGG + Intergenic
975903266 4:79178981-79179003 CAAGAGAGAGAGAAGGGGTTTGG + Intergenic
976232584 4:82860085-82860107 TAAAAAAAAGAAAAGTGGCCAGG - Intronic
976248419 4:83026445-83026467 TAAAACAGAGGGAAGAGGTCGGG - Intergenic
976307426 4:83574852-83574874 AAAAAAAGAAAGAAATGTTCGGG - Intronic
977564637 4:98568558-98568580 CAAAAAAAAGAAAAGAAGTCTGG + Intronic
977792326 4:101122197-101122219 AGAAAAAGTCAGAAGTGGTCAGG - Intronic
978088400 4:104684335-104684357 CAAGAAAGAGAGAGGTGATATGG - Intergenic
978581023 4:110231388-110231410 CAAAAAAGAGACATATGGCCAGG - Intergenic
978857881 4:113413755-113413777 AAAAAAAGAGAGAAATGATGGGG + Intergenic
979527020 4:121728158-121728180 AAAAAATGAGAAAAATGGTCAGG - Intergenic
979718060 4:123865656-123865678 ACAAAAAGAGAGAAGTGGTACGG + Intergenic
979841347 4:125445158-125445180 GAAAGAATAGAGAAGTGGTTTGG - Intronic
980118717 4:128706370-128706392 GATAAAAGAAAGAAGTGGCCAGG + Intergenic
980502377 4:133673093-133673115 CAAAAATTAAGGAAGTGGTCGGG - Intergenic
980513153 4:133820373-133820395 CAAAAAAAAAAAAAGTAGTCGGG + Intergenic
981035821 4:140167876-140167898 TAAAAAAGAGAAAATTGGCCTGG - Intergenic
981995962 4:150975864-150975886 CAAAAAGGAGAGTAGAGGCCGGG + Intronic
982741873 4:159065750-159065772 CAAAGTAGAGAGAAGTCATCTGG + Intergenic
982864364 4:160491410-160491432 AAAAAAAGAGACAAATTGTCTGG + Intergenic
983033047 4:162827570-162827592 CAAAAAATAGAAAAGAGGCCGGG + Intergenic
983237909 4:165200540-165200562 TAAGAAAGAGAAAAGTGGCCGGG - Intronic
983246523 4:165293810-165293832 TTAAAAAGAGAGAATTGGGCCGG - Intronic
984370258 4:178855308-178855330 TAAAATAGAGAGTATTGGTCAGG + Intergenic
984717333 4:182938047-182938069 CAAACAACAGAGACCTGGTCAGG - Intergenic
984748950 4:183253201-183253223 CAGCAAAGAGAGCAGTGGTGTGG - Intronic
985181789 4:187272688-187272710 TAAAGAAGGGAGAAGTGGCCGGG + Intergenic
985861242 5:2472257-2472279 CAAAAATGAAAAAAGTGGCCGGG + Intergenic
986328939 5:6703279-6703301 AAAAAAAGAAAGAAGAGGCCGGG + Intergenic
987503021 5:18737432-18737454 CAAAATTGTGAGAAGTTGTCTGG - Intergenic
988100724 5:26673838-26673860 GAAGAAGGAGAGAAATGGTCTGG + Intergenic
988231044 5:28479745-28479767 GAAAAAAGAGAGAAGGGGACCGG - Intergenic
988345206 5:30028144-30028166 CATAAAAGTAAAAAGTGGTCTGG - Intergenic
988814051 5:34814948-34814970 AAAAAAAGAGACAAGAGGGCTGG + Intronic
989040850 5:37227012-37227034 CAAAAAGGACATAAGTTGTCTGG + Exonic
989177559 5:38543721-38543743 ACAGAAAGAGAGAAGTGGGCTGG - Intronic
989813621 5:45709032-45709054 CAAAGTAGAGAGAAGTGGTCAGG - Intergenic
989821764 5:45801137-45801159 CAAAAAGGAGAGAAGAGCTGTGG + Intergenic
990304670 5:54482462-54482484 TTAAAAAGAGAGCAGTGGTCAGG - Intergenic
990563773 5:57008778-57008800 CAAAAAATAGAGAAGTTAGCTGG + Intergenic
990873076 5:60454896-60454918 TAAACAAGAGAGAAGGGGTGGGG + Intronic
991087628 5:62662663-62662685 AAAAAAAAAGAGAAGTTGCCAGG + Intergenic
991106875 5:62853262-62853284 CAAAAGTGAGAGAAGAGATCAGG + Intergenic
991381446 5:66032026-66032048 AAAAAAAGAGAACAGTGTTCTGG + Intronic
991900312 5:71454037-71454059 AAAAAAAGAGAGAAATGTACAGG - Intergenic
993031279 5:82708656-82708678 CAAGAAAGAGATAATTGGCCGGG - Intergenic
993037478 5:82773590-82773612 CAAGGAATGGAGAAGTGGTCTGG + Intergenic
993417988 5:87659165-87659187 CATAAAAGAGAGAAGCGTCCTGG + Intergenic
993699281 5:91099267-91099289 CAAAAAAAAAAAAAGTGTTCGGG + Intronic
993824822 5:92669990-92670012 CAAAAAAGACTGAAGTGGTATGG - Intergenic
995015111 5:107301195-107301217 CAAAAAAGACAGAAGTTGGAGGG + Intergenic
996008774 5:118456938-118456960 CAAAAAAGAAAGAAGGAGACCGG - Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996564524 5:124865466-124865488 CAAAAAAGAGAAAAGTTAGCTGG + Intergenic
996582389 5:125046212-125046234 AAAAAAAGAGAGAAATGGAGGGG - Intergenic
997132174 5:131287946-131287968 CAAAAATGGGAGAAGTGGCCGGG + Intronic
997601340 5:135140767-135140789 CAAGAAAGAGAGAAGTGCATGGG + Intronic
997831128 5:137150994-137151016 CACAAGAGAAAGAAGTGGCCAGG - Intronic
997918574 5:137954774-137954796 CAAAAAAAAGAAAATTAGTCAGG - Intronic
998238950 5:140425552-140425574 CAAAAAACAGAAAAGAGGCCTGG - Intronic
998804818 5:145907720-145907742 GAAGAAAGAGAGAAGTGTTGGGG + Intergenic
999567138 5:152876919-152876941 CAAAAAAGAGAGAAAACCTCAGG + Intergenic
999694974 5:154180639-154180661 CAAAACACAGAGAGGTGGTGGGG - Intronic
1000535196 5:162470579-162470601 AAAAAAAGAAAGAAATGGTTGGG - Intergenic
1001445460 5:171779343-171779365 ATAAAATGAGAGAAGTAGTCTGG - Intergenic
1002674522 5:180900036-180900058 CAAAAAAGATATAGGTGGACAGG - Intronic
1002707557 5:181172753-181172775 CAAAAAACAAAGAACTGGTCTGG - Intergenic
1002974474 6:2060731-2060753 CCAAAAAGAAAGAAGGGGGCCGG + Intronic
1003199677 6:3947576-3947598 CAAAAATCAGAGAAATGGCCGGG - Intergenic
1003543607 6:7039764-7039786 TAAAAAAAAGAGAAGTCGGCTGG - Intergenic
1003574047 6:7276588-7276610 CAAAAAACATAGAAGTGGGCCGG + Intronic
1003666001 6:8111876-8111898 GGAAGAAGAGGGAAGTGGTCTGG + Intergenic
1003711386 6:8594893-8594915 CAAAAAAAAGAGAATTTGCCAGG + Intergenic
1003767082 6:9250414-9250436 AAAAAAAGAAAAAAGTGTTCAGG - Intergenic
1006008542 6:31022511-31022533 CAAAAAAGAATGAAGTGTGCTGG + Intronic
1006112375 6:31755655-31755677 CAAAAAATAAAAAATTGGTCAGG - Intronic
1006619009 6:35349318-35349340 CAAGAAAGAAAGAAGAGGCCGGG - Intronic
1006706736 6:36027355-36027377 TAAAAAAGAGACAAGTGGCCGGG - Intergenic
1006742319 6:36318151-36318173 CAAGAAAGACAGAAGTGTTTCGG + Intronic
1007388312 6:41534409-41534431 AAAGAAAAAGAGAAGGGGTCTGG + Intergenic
1008485438 6:52030184-52030206 CAAAGAAGAGGGATGTGGTGTGG + Intronic
1008584364 6:52935499-52935521 TAAAAAATAGACATGTGGTCGGG + Intergenic
1008841917 6:55912909-55912931 TAAAAATCAGGGAAGTGGTCAGG + Intergenic
1009024514 6:57982880-57982902 CAAAAGAGCCAGAAATGGTCAGG + Intergenic
1009200096 6:60734350-60734372 CAAAAGAGCCAGAAATGGTCAGG + Intergenic
1009768808 6:68118796-68118818 GAAAAAAGAAAGATGGGGTCAGG + Intergenic
1010337641 6:74705395-74705417 CAAAATAGAGAGCAGTGGCCAGG + Intergenic
1010734202 6:79424748-79424770 CAAAAAAGGGCAAAGTTGTCTGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1011739606 6:90346866-90346888 CTAAAAATAGAGAAGTGGATAGG + Intergenic
1011764227 6:90602451-90602473 CAAAAAAAAGAGAACTAGTTAGG - Intergenic
1011918716 6:92544194-92544216 AAAAAAAAAAAGAAGTGATCAGG - Intergenic
1011930510 6:92705400-92705422 CAGAGACGAGAGAAGTGGTATGG + Intergenic
1011960196 6:93079211-93079233 CAAAAAAGAGAGGAGGGACCTGG + Intergenic
1012250408 6:96974015-96974037 AAAAAAAAAGAGAAGAAGTCAGG - Intronic
1013324732 6:109033208-109033230 CTAAAGAGAGTGCAGTGGTCTGG + Intronic
1013525896 6:110973715-110973737 TAAAAAATAGAGAAGGGGTTTGG + Intergenic
1013780724 6:113725934-113725956 CAAAAAATAGAGCAGGGGCCAGG - Intergenic
1014269478 6:119320636-119320658 AAAAAAAGAGGTATGTGGTCGGG + Intronic
1015170673 6:130249045-130249067 CAGGAAAGAGAGAGGTGTTCTGG - Intronic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1017726707 6:157281286-157281308 TTAAAAAGAGAAAAGTGGCCGGG + Intergenic
1017805414 6:157941438-157941460 CAAAAAAGCGAGATGTGGGATGG + Intronic
1017820700 6:158047141-158047163 CAAAAATAAGTGAAGAGGTCTGG + Intronic
1017864694 6:158432844-158432866 CAAAAAAGTGGGGAGTGGTGAGG - Intronic
1020187264 7:5968809-5968831 CAAAAAACACAGAACTGGGCCGG - Intronic
1020205030 7:6107702-6107724 AAAAAAAGAAAGAAGAGGCCGGG - Intronic
1020273342 7:6610052-6610074 CAAAAAAGAGAAAATTGGCTGGG + Intergenic
1020295652 7:6755963-6755985 CAAAAAACACAGAACTGGGCCGG + Intronic
1020664349 7:11020672-11020694 AAAAAAAGAAAGAAGTGGTCAGG - Intronic
1020704250 7:11523651-11523673 CAAACAATAGAAAAGTTGTCTGG + Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1021058434 7:16079901-16079923 CAAAAAAGACAGTGTTGGTCAGG + Intergenic
1021393438 7:20121711-20121733 CAACATGGAGAGAAGGGGTCGGG - Intergenic
1021651168 7:22835186-22835208 CTAACAAGAGAGCAGTGGCCAGG + Intergenic
1021883877 7:25119570-25119592 TAAAAAAAAAAAAAGTGGTCTGG - Intergenic
1021890921 7:25185592-25185614 TTAAAAAGACAGAAGTGGTAAGG - Intergenic
1021939689 7:25667513-25667535 AAAAATAGAGAGAAGAGGCCAGG + Intergenic
1022407553 7:30105483-30105505 CAAAAAAGAAAAAAGTTATCAGG + Intronic
1022454531 7:30546777-30546799 CAAAAAAATCAGAGGTGGTCTGG + Intronic
1023224792 7:37958032-37958054 CAAAACAGAGAGATTTGGCCAGG + Intronic
1024239958 7:47427137-47427159 AAAAAAAAACAGAAGTGCTCAGG + Intronic
1025066219 7:55857880-55857902 CAAAAAAGACACAGGTGGCCGGG - Intronic
1026350109 7:69508311-69508333 AAAAAGAGAGAGAAGTGGCCGGG + Intergenic
1027602591 7:80257421-80257443 CAATAAAGAGAAAGGTGGTAGGG + Intergenic
1027698763 7:81442762-81442784 AAAAAAAAAAAGAAGTGCTCTGG - Intergenic
1027952179 7:84830900-84830922 CAGAAAAGACAGAAGTGCTCAGG + Intergenic
1028068408 7:86417583-86417605 AAAAAAATAGAGAAGTGGCCAGG - Intergenic
1028518280 7:91701274-91701296 CAAAAAAGACAAAAGTGGCCAGG + Intronic
1029108615 7:98198482-98198504 AAAAAAAGAGAAAAGAGGCCAGG - Intronic
1029293959 7:99524505-99524527 CAAAAAATAGAGTATTGGCCAGG - Intronic
1029372999 7:100160977-100160999 CAGAAGAGAGAGAACTGGGCTGG + Intronic
1029665154 7:101990348-101990370 CAAACAAAAGAGATGGGGTCTGG - Intronic
1029675767 7:102067529-102067551 AAAAAAATAGAGTTGTGGTCAGG - Intronic
1030042938 7:105468226-105468248 TAAGAAAGAGAGATGTGGTGAGG - Intronic
1032459618 7:132100975-132100997 CAAAAAAGAAAGAATTGATTTGG + Intergenic
1032515198 7:132501659-132501681 CCAAAAAGAGGGAGGTGGGCGGG + Intronic
1032728723 7:134616419-134616441 AAAAAAAGAGAGTAGAGTTCTGG + Intergenic
1032786163 7:135201673-135201695 TAAAAAAGAAAGAAGGGCTCTGG + Intronic
1033136354 7:138787700-138787722 CAAAAAAGAAAAAAGAGGCCAGG + Intronic
1034392579 7:150798568-150798590 CTAAAAAAAGAGAACTGGCCGGG - Intronic
1034457758 7:151180590-151180612 CCAAAAAGACAGAAGAAGTCAGG - Intronic
1034915733 7:155037333-155037355 AAAAAAAAAGAGAAGTGGATTGG - Intergenic
1034920304 7:155074161-155074183 GAAACAAGAGAGAAGTGTTGTGG - Intronic
1035818616 8:2567135-2567157 CAAAAGAGATAGAAGTGATCAGG - Intergenic
1035847386 8:2879947-2879969 CAAAAAACAGAAAAGTGGCTGGG - Intergenic
1036009549 8:4706710-4706732 CAAAAGACAGAGATGTGGCCGGG + Intronic
1036729682 8:11251172-11251194 GAAAAAAAAGGGAAGTGGCCGGG + Intergenic
1036928777 8:12932345-12932367 AAAAAGGGAAAGAAGTGGTCGGG + Intergenic
1037026599 8:14045669-14045691 AAAAAAAGAGAGAAATGGCTTGG + Intergenic
1037107955 8:15132843-15132865 CAAAAATAAAAGAAGTGGCCAGG + Intronic
1037186253 8:16067150-16067172 TAAAAAAGAGAGAAGCTCTCTGG + Intergenic
1037200631 8:16248587-16248609 AAAAAAAGAGACAAGAGATCAGG + Intronic
1037672182 8:21024462-21024484 TAAAAAAGAGAGCAGTGGCCGGG - Intergenic
1038362004 8:26889485-26889507 CAAAGAAGAGAGAAGAGATGTGG - Intergenic
1039335683 8:36586834-36586856 GAAAGAAGAGAGTAGTGGCCAGG + Intergenic
1039516611 8:38139067-38139089 CAGAAAAGAGGGACCTGGTCAGG - Exonic
1039547830 8:38422398-38422420 AAAAAGAGAGAGAAGGGGTTAGG - Intronic
1039591625 8:38754865-38754887 CATAAAAGAGAGATCTGGCCGGG + Intronic
1040500747 8:48002914-48002936 AAAGAAAGAGAGAATTGGCCAGG + Intergenic
1040699167 8:50040078-50040100 TATAAAACAGAGAAGTGGACAGG + Intronic
1041282773 8:56228313-56228335 AACAAAAGAGAGAAGAGGCCAGG + Intergenic
1041498350 8:58511913-58511935 CAAAGAAGAGAGAACAGGCCAGG - Intergenic
1041963717 8:63649661-63649683 GAAAAAGGAGAGAACTGGTAGGG + Intergenic
1042225264 8:66510350-66510372 CAAGAAAGAGAGAAGCAGCCAGG - Intronic
1042808132 8:72794167-72794189 ACAAGTAGAGAGAAGTGGTCAGG + Intronic
1043793190 8:84499913-84499935 AAAAATAGAGAAAATTGGTCGGG - Intronic
1044626689 8:94241023-94241045 GAAAAAAGACAGAAGTGGACAGG - Intergenic
1045308121 8:100976526-100976548 CAAAAATGAGAGATGTGGTTGGG - Intergenic
1045841241 8:106584306-106584328 AAAAAAAGAGAGGGGTGTTCGGG + Intronic
1045934304 8:107661315-107661337 GAAAAATGAGAGAATTGGTGAGG + Intergenic
1046276684 8:111970899-111970921 AAAAAAAAAGATAAGTGGTTAGG + Intergenic
1046695573 8:117335704-117335726 CAAATGGGAGAGAAGTGTTCTGG + Intergenic
1046723661 8:117651416-117651438 AAAAAAAGAGAGAAGGGGCCGGG + Intergenic
1046793732 8:118348362-118348384 AAAAAAAGTAATAAGTGGTCAGG - Intronic
1046942987 8:119949079-119949101 CAAAATACAGAAATGTGGTCGGG - Intronic
1047231341 8:123000640-123000662 CAAAAAAGAAAGAAGGGGAGAGG + Intergenic
1047673166 8:127171135-127171157 CAAGAAAGAGAGCAGTGCACTGG - Intergenic
1047868680 8:129058070-129058092 CATTAAAGAGAGAAATGGTCAGG - Intergenic
1047965087 8:130040528-130040550 AAAAAAAAAAAAAAGTGGTCTGG + Intergenic
1048600592 8:135915364-135915386 ACAAAAAGAGAGAAGTTGTAGGG + Intergenic
1049055011 8:140229565-140229587 CAAAAAAGAAAAAAGAGGCCGGG - Intronic
1051055306 9:12978234-12978256 AGAAAAAGACTGAAGTGGTCAGG - Intergenic
1051460358 9:17306442-17306464 CATAAAATAGAGCACTGGTCAGG - Intronic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1051953569 9:22663085-22663107 AAAAAAGCAGAGAAGGGGTCAGG + Intergenic
1052355597 9:27501884-27501906 CAAAAAAAAGAGAAGTTATTAGG + Intronic
1052963893 9:34324300-34324322 CAAAGAAGAGAGAAGTGGAGGGG - Intronic
1053194301 9:36103742-36103764 CAAAAAAGAGAGCATTAGACTGG + Intronic
1055075881 9:72214588-72214610 CATAAAAGACAGATGTGGGCTGG - Intronic
1055345448 9:75331713-75331735 AAGAAAACATAGAAGTGGTCAGG + Intergenic
1056150435 9:83782135-83782157 AAAAAAAGAAAGAAGTGGCTGGG - Intronic
1056434715 9:86564711-86564733 CAAAAAAAAGAGAGTTGGTAAGG - Intergenic
1056486445 9:87062761-87062783 TAAAAAAGAGAGAGATGGTTTGG + Intergenic
1056637087 9:88340095-88340117 CAAAAAAAAAAAAAGTGGCCTGG + Intergenic
1056672834 9:88646114-88646136 CAAAAAAGAGACATGTGGCCGGG + Intergenic
1057535304 9:95896718-95896740 CAAAAAAGCAACAACTGGTCTGG - Intronic
1057826231 9:98374219-98374241 CACAAAATAGACAAGTGGCCTGG - Intronic
1058828151 9:108793367-108793389 CAAAAGAAAGAGAGGTGGTAGGG - Intergenic
1058899054 9:109425715-109425737 CAAAAAAGAGAGAATAGGCTGGG + Intronic
1059238935 9:112786414-112786436 CAGAAAAGAGACAAGAGGCCAGG - Intronic
1059688284 9:116658720-116658742 AAAAAAAAAGAGCGGTGGTCAGG - Intronic
1059841010 9:118216369-118216391 CAGGAAAGAGACAAGTGGACTGG + Intergenic
1060861622 9:126959582-126959604 AAAAAAAAAAAGAACTGGTCAGG - Intronic
1061072492 9:128319912-128319934 CAAAAAAAAAAAAAGTGGCCAGG - Intronic
1061317445 9:129805149-129805171 AAAAAAAGAGAGATGTAGTCAGG + Intronic
1061380023 9:130250113-130250135 CAAAAAAGAAAGAAGGGGAAGGG - Intergenic
1062245462 9:135563732-135563754 TTAAAAAGACAGAGGTGGTCAGG + Intronic
1062456419 9:136641405-136641427 GAGAAAAGAAAGAAGTGGCCTGG + Intergenic
1203346167 Un_KI270442v1:36062-36084 CTGAAAAGAGTGGAGTGGTCTGG + Intergenic
1185829705 X:3288919-3288941 CAAAAAAGGCAGAAGTGGAGGGG + Intergenic
1186043839 X:5511866-5511888 CAAAAAAGAGATGAGAGGACCGG + Intergenic
1186342609 X:8659958-8659980 CAAAAAAGAGAGTAGATGGCAGG + Intronic
1186466551 X:9787934-9787956 AAAAAAAAAGAGGAGTGTTCTGG - Intronic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1186649415 X:11542514-11542536 ATAAAAAGAGAGAATTGGTGGGG + Intronic
1187385549 X:18845144-18845166 CCAAATAGAGAGAGGTGGTGGGG - Intergenic
1188016114 X:25110262-25110284 CAAAAAACAAAGAGGTGGGCCGG - Intergenic
1188370644 X:29365741-29365763 TAAAAAAGAAAGAAATGGTCCGG + Intronic
1188437069 X:30173101-30173123 GATAAAAGAGAGAAGAGGACTGG + Intergenic
1188868113 X:35339912-35339934 TAAAGAAGAAACAAGTGGTCAGG - Intergenic
1189370852 X:40427890-40427912 CAAAAATCAGAGAAGTTGGCCGG - Intergenic
1189507183 X:41623705-41623727 CAAAAAAAAGAAAAGGGGCCAGG - Intronic
1189969787 X:46406371-46406393 AAAAAAAGAGTGCATTGGTCAGG + Intergenic
1190402632 X:50054198-50054220 CAAAGAAGAGAGTAGAGGGCAGG - Intronic
1192768140 X:74163044-74163066 CAAAAAAGAGAGAGAAGTTCTGG + Intergenic
1193169730 X:78321699-78321721 AAAAAAAGGCATAAGTGGTCTGG + Intronic
1193818664 X:86134872-86134894 CAAAGAAAAAAGAAGTGATCAGG + Intergenic
1194686332 X:96922365-96922387 CAAAAAAGAAAGAAGTGTTGAGG - Intronic
1195665853 X:107429738-107429760 CAAAAAAGAGACAAAAGGCCAGG + Intergenic
1195765034 X:108287014-108287036 GAAAGAAGATAGAAGTAGTCTGG + Intronic
1196497951 X:116344913-116344935 CAAAAAAGAGAGAGGTGAAGAGG + Intergenic
1196978751 X:121188342-121188364 CACACAAGAAAGAAGTGGTATGG + Intergenic
1197056914 X:122132893-122132915 GAAAAAAGAGAGAAGTTGAAAGG - Intergenic
1197549793 X:127876315-127876337 AAAAAAAAAGACAAGTGGTGAGG - Intergenic
1197720789 X:129743277-129743299 AAAGAAATAGAGAACTGGTCTGG + Intronic
1197934895 X:131729843-131729865 CAAAAAAGAGAAAAGGAGCCGGG + Intergenic
1198044371 X:132886041-132886063 CAGAAAAGTGAGATGTGCTCAGG + Intronic
1199337823 X:146640967-146640989 GATAAAAGAGAAAATTGGTCTGG - Intergenic
1199356893 X:146873261-146873283 CATAAAAGAGAGAACTGGGTTGG + Intergenic
1199471798 X:148203967-148203989 GAAAAAAGAGAGAAGAGGGAAGG + Intergenic
1199486566 X:148354860-148354882 CAAAAAAGAGAGAGATGGAAAGG - Intergenic
1199751806 X:150826735-150826757 GAAAAGACAGAGAAGTTGTCAGG - Intronic
1201692179 Y:16779296-16779318 CAAAAAAAAAAAAAGAGGTCGGG - Intergenic