ID: 1148882535

View in Genome Browser
Species Human (GRCh38)
Location 17:50740936-50740958
Sequence CTGTGTAAAGCTCTATGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148882530_1148882535 9 Left 1148882530 17:50740904-50740926 CCAGTACAGTGGTAAAGCTAGTG 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1148882535 17:50740936-50740958 CTGTGTAAAGCTCTATGATGAGG 0: 1
1: 0
2: 0
3: 9
4: 183
1148882527_1148882535 30 Left 1148882527 17:50740883-50740905 CCTAGGTCCAGGGTCATAGATCC 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1148882535 17:50740936-50740958 CTGTGTAAAGCTCTATGATGAGG 0: 1
1: 0
2: 0
3: 9
4: 183
1148882528_1148882535 23 Left 1148882528 17:50740890-50740912 CCAGGGTCATAGATCCAGTACAG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148882535 17:50740936-50740958 CTGTGTAAAGCTCTATGATGAGG 0: 1
1: 0
2: 0
3: 9
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148882535 Original CRISPR CTGTGTAAAGCTCTATGATG AGG Intronic
900835512 1:5000435-5000457 CTGGGTCAAACTCTCTGATGGGG + Intergenic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907083987 1:51651769-51651791 ATGTGTAAAGTTCTATGATTAGG + Intronic
908593599 1:65660142-65660164 CTGTGTAATATTCTATGATAGGG + Intergenic
909398174 1:75194234-75194256 CTGTGTAAGACCCCATGATGAGG + Intergenic
909878839 1:80847513-80847535 CTCTGTCAAGCTCTTTGATAAGG + Intergenic
910267384 1:85352201-85352223 CTGTGCACAGCTCTGGGATGTGG - Intronic
910788549 1:91026530-91026552 ATGTGTAAAGCTCTGTGCTCAGG - Intergenic
911817434 1:102370996-102371018 CTGTATAAAGCACATTGATGGGG + Intergenic
911886618 1:103308996-103309018 GTGTGAAAAGCTCTTAGATGAGG - Intergenic
913709677 1:121470256-121470278 CTATGAAAAGAACTATGATGAGG - Intergenic
914786089 1:150832439-150832461 CTGTGGAAAGTTCTTTGATAGGG - Intronic
915682006 1:157590412-157590434 CTGTGTAAATCTCAATCATCTGG + Intronic
915885262 1:159714927-159714949 CTTTGTCAAACTCTATGATTTGG - Intergenic
917403078 1:174673882-174673904 CTGTGTGAAGCTAAATAATGAGG - Intronic
919666713 1:200299798-200299820 CTGTGGAATGCTATATTATGTGG + Intergenic
920936465 1:210439769-210439791 CTGTGTAAGGCTTTCAGATGAGG - Intronic
923270209 1:232348468-232348490 CAGTGTCAATCTCTATGTTGTGG + Intergenic
1063858503 10:10282384-10282406 CTATGTAGATCTCTATCATGTGG + Intergenic
1066210885 10:33237091-33237113 ATGTGTGAAGCTCCATGATTGGG - Intronic
1068115901 10:52737145-52737167 CTGTGTAGTGCTCTCTGATTTGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078633624 11:13028983-13029005 CTGGAAAAAGCTCTATGATTTGG + Intergenic
1079749388 11:24178099-24178121 CTGTGAACAGTTCTATTATGAGG + Intergenic
1080215646 11:29836939-29836961 CTGTGCATAGCACTATGTTGTGG - Intergenic
1080912878 11:36622708-36622730 ATGTGTAAAGTTTTATGATTGGG + Intronic
1081758886 11:45563185-45563207 CTGTGTTGAGGTCTGTGATGAGG - Intergenic
1087122845 11:94592864-94592886 CTGTGTAAACCACTAGCATGGGG - Intronic
1087624487 11:100581461-100581483 CTGTGCAAAGCAATGTGATGTGG - Intergenic
1088007601 11:104961466-104961488 TTGTCTGTAGCTCTATGATGGGG + Intronic
1088695936 11:112366004-112366026 TTGTGTATAGCCCTATGCTGTGG + Intergenic
1089401111 11:118165173-118165195 CTGTGTCCTGGTCTATGATGGGG - Exonic
1090055922 11:123424869-123424891 CTGTGTAAAGCTCCTTGTTCAGG - Intergenic
1090097580 11:123758051-123758073 TTGTGTCAAGCTCTATGCTTCGG - Intergenic
1093193732 12:16105719-16105741 CTGGGCAGAGTTCTATGATGGGG + Intergenic
1093887258 12:24476364-24476386 CTTTGCAAAGATCTGTGATGAGG - Intergenic
1096999030 12:55860220-55860242 CTCTGTAAAGCTGTATTTTGTGG - Intergenic
1098616475 12:72530950-72530972 CTGTGTAAGGCACTTTGATAGGG - Intronic
1098807972 12:75044637-75044659 CGGGGTAAAGCTCTCTTATGAGG + Intronic
1099673734 12:85729882-85729904 CTGTGTAATGCTGAATGCTGTGG + Intergenic
1103204624 12:119118848-119118870 CTCTGTAAAGCTCTAAGACCTGG - Intronic
1106261539 13:28071606-28071628 CTATCCTAAGCTCTATGATGTGG + Intronic
1106284668 13:28308302-28308324 CTCTCTAAAGCCCTGTGATGTGG - Intronic
1108075917 13:46679723-46679745 CTCTGTACAGCTGTCTGATGGGG - Intronic
1108557048 13:51603811-51603833 CTTTGTAAAGCTTTATTATTAGG + Intronic
1109532390 13:63666803-63666825 CATTGTAAACTTCTATGATGTGG + Intergenic
1109550014 13:63883306-63883328 ATGTGTTAAGTTGTATGATGAGG + Intergenic
1112802913 13:103132397-103132419 CTGCTTAAAGTTCAATGATGGGG + Intergenic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1115117487 14:29899771-29899793 ATGTGCAAAGCACTATGATATGG + Intronic
1125266278 15:37885132-37885154 CTGTGTGAAGCTTGCTGATGGGG + Intergenic
1127983860 15:64053222-64053244 GTGTTGGAAGCTCTATGATGAGG - Intronic
1129052237 15:72791620-72791642 CTGTGAAAGGCTCTATTAAGAGG - Intergenic
1129334064 15:74842153-74842175 CTGCGCAAAACTCCATGATGAGG + Exonic
1130541340 15:84822656-84822678 CTGTGTAGGGCACTAGGATGAGG - Intronic
1131613067 15:93985402-93985424 ATGTGTAGAGCTGTATAATGAGG + Intergenic
1134423278 16:14114224-14114246 CTTTGTAAAGCACTATGGTCTGG - Intronic
1135181824 16:20281510-20281532 CAGTGCAAAGCTCTGAGATGGGG + Intergenic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1139206205 16:65031383-65031405 ATGTGAAAAGTTCTTTGATGGGG + Intronic
1140447038 16:75037907-75037929 ATGTGGAAAAGTCTATGATGAGG + Intronic
1141562922 16:84881774-84881796 CTGAGTAAAGCTCTATCTGGAGG - Intronic
1141843619 16:86591646-86591668 ATGTGTCAAGCTCTGTGCTGAGG + Intergenic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1144070799 17:11669633-11669655 CTATGAAACGCTCTATGAAGAGG + Exonic
1144221089 17:13100501-13100523 CTGTGTGAAGCTATAGGCTGTGG + Intergenic
1145189889 17:20830032-20830054 GTTTCTAAAGCTCTAGGATGTGG + Intergenic
1146330528 17:31923302-31923324 TTGAGTAAAGCTCTATATTGCGG + Intergenic
1148882535 17:50740936-50740958 CTGTGTAAAGCTCTATGATGAGG + Intronic
1151094850 17:71485268-71485290 CTGTGTACAGCTAAATGATTGGG + Intergenic
1151895966 17:76981228-76981250 CTGTGTAGAGGTCTCTGCTGGGG + Intergenic
1203171558 17_GL000205v2_random:153232-153254 CTTTGTAATGTTCTATAATGGGG - Intergenic
1158121470 18:54052930-54052952 CTCTGGAAAGCACAATGATGAGG + Intergenic
1162596448 19:11633365-11633387 CTGTGTAAACGTGTCTGATGTGG - Intergenic
1164650383 19:29887032-29887054 CTATGTAAAGATCTGTGAGGAGG - Intergenic
925435226 2:3831254-3831276 CTGTGCATTGCTCAATGATGGGG + Intronic
925662570 2:6218425-6218447 ATGTATAAACCTCTATGATTTGG + Intergenic
927122384 2:19978027-19978049 CTGTGATAAGCGCTAAGATGGGG - Intronic
927733104 2:25493239-25493261 CTTTGTAAAGCATTATTATGGGG - Intronic
928882375 2:36112406-36112428 CTGTGTAATACTCTGTCATGTGG - Intergenic
930157456 2:48119997-48120019 GGGTGTAAAATTCTATGATGTGG + Intergenic
933394624 2:81715166-81715188 CTCTGCAAAGTTCTATGATAAGG + Intergenic
935353291 2:102174305-102174327 CTGTGGAATGCTCTATCCTGTGG + Intronic
935804514 2:106732680-106732702 CCGTGTGAAGCTGTGTGATGGGG + Intergenic
936696221 2:114951776-114951798 ATGTGTAAAACTCTAATATGAGG - Intronic
937384021 2:121409562-121409584 GTGTGTAAAGTTCTAGGAGGCGG - Intronic
943402893 2:187438211-187438233 TTGTGTAAAGATCCATAATGAGG + Intronic
945765788 2:213976028-213976050 CTGTATGAAGCTGTATGAAGAGG - Intronic
947042886 2:225943893-225943915 CTGTGAAATGCTCTATGGTGAGG + Intergenic
1169703692 20:8477906-8477928 CTATGTAAAGCACTAAGATGTGG - Intronic
1175339680 20:58220422-58220444 CTATGTAAAGCTCTTTAATTTGG + Intronic
1176327535 21:5515063-5515085 CTTTGTAATGTTCTATAATGGGG - Intergenic
1176330168 21:5541185-5541207 CTTTGTAATGTTCTATAATGGGG + Intergenic
1176397589 21:6279766-6279788 CTTTGTAATGTTCTATAATGGGG - Intergenic
1176400222 21:6305888-6305910 CTTTGTAATGTTCTATAATGGGG + Intergenic
1176436935 21:6683216-6683238 CTTTGTAATGTTCTATAATGGGG - Intergenic
1176439568 21:6709338-6709360 CTTTGTAATGTTCTATAATGGGG + Intergenic
1176461197 21:7010286-7010308 CTTTGTAATGTTCTATAATGGGG - Intergenic
1176463830 21:7036407-7036429 CTTTGTAATGTTCTATAATGGGG + Intergenic
1176484758 21:7392064-7392086 CTTTGTAATGTTCTATAATGGGG - Intergenic
1176487391 21:7418186-7418208 CTTTGTAATGTTCTATAATGGGG + Intergenic
1177047526 21:16188857-16188879 CAGTGAAAGGCTCTAAGATGGGG - Intergenic
1179313961 21:40224514-40224536 ATGGGAAGAGCTCTATGATGGGG + Intronic
1181441592 22:22938807-22938829 CTGTGTACTCCTCTGTGATGTGG + Intergenic
1182255751 22:29037134-29037156 CTCTGTCAAGCTCTTGGATGTGG - Intronic
1183576305 22:38692137-38692159 CTGTGCCAAGCACTATGATAAGG + Intronic
952255623 3:31692982-31693004 CTGTGTAAATCTGTTTCATGAGG - Intronic
955130895 3:56167282-56167304 TTGTGTACAGCACCATGATGAGG - Intronic
955371541 3:58356186-58356208 CTGTGTCAAGCCCTAGCATGTGG - Intronic
958489948 3:94759841-94759863 CTGTGCACAGATCCATGATGAGG - Intergenic
959986577 3:112580009-112580031 CTGTTTAATGCTCTACGATTAGG + Intronic
960309519 3:116104083-116104105 CTGTGTAGAACTCAGTGATGGGG - Intronic
964848643 3:161070364-161070386 CTGGGGAAAGCTCCCTGATGTGG - Exonic
965235951 3:166123309-166123331 CTCTGTAAAGCTTTTTGAGGAGG - Intergenic
965970376 3:174547377-174547399 CATTGTTAAGCTCTAGGATGTGG + Intronic
967095736 3:186175696-186175718 CTTTGTAAAGCTCTAGGCTGCGG - Intronic
969974172 4:11081175-11081197 TTGTGAAATGCTCTATGAAGAGG + Intergenic
972216605 4:36905071-36905093 CTCTATGAAGCTCTATGAAGAGG - Intergenic
974056783 4:56991562-56991584 CTGTGTCTAGCTCTATTTTGGGG - Intronic
977083349 4:92561632-92561654 CTGAGTAAAGCTTTATAGTGTGG + Intronic
980564124 4:134516583-134516605 CTGTGAAAAGTTACATGATGTGG + Intergenic
980749642 4:137071255-137071277 CTGGGAGAAGCTCTCTGATGTGG - Intergenic
983293884 4:165840844-165840866 CTGTGCTAATCTCCATGATGGGG + Intergenic
983294180 4:165844747-165844769 CTGTTTTTAGCTATATGATGAGG + Intergenic
985432957 4:189898976-189898998 AAGTGTAAAGCTCTATAATTAGG - Intergenic
985717066 5:1468654-1468676 CTGTGTAAAACCTTAAGATGTGG - Intronic
986929122 5:12795749-12795771 CTGTGCCAACCTCTGTGATGGGG - Intergenic
988481928 5:31638801-31638823 CTGTGTAAAGTGCTATGCAGAGG + Intergenic
989350844 5:40484812-40484834 CTGTGTGAATCTCTCTGAAGAGG + Intergenic
990086049 5:51979119-51979141 ATGTGTCAGGCACTATGATGAGG - Intergenic
992647150 5:78821657-78821679 TTGTATAAAGCACTATGAGGAGG + Intronic
994873108 5:105379129-105379151 CTGTATCAAGTTGTATGATGAGG - Intergenic
995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG + Intronic
995566590 5:113437316-113437338 GTGTGTAAAGCTCTGTGCTGAGG - Intronic
995880340 5:116837687-116837709 CAGTGTAATGCTTTAGGATGTGG - Intergenic
996000112 5:118351002-118351024 CTCTGTAAAGCTGTGTAATGGGG - Intergenic
996146141 5:119979486-119979508 CTGAGTAAAGCACTATGAAAAGG - Intergenic
997005133 5:129807501-129807523 GTGTGTCAAGTTCTGTGATGAGG + Intergenic
998758590 5:145407350-145407372 CTGTGGCAACCTATATGATGGGG + Intergenic
1001241038 5:170070042-170070064 CTGTGTAAGCCTCTATGAGAGGG - Intronic
1003549291 6:7087747-7087769 CTGTGAAAAGTTCTAAGCTGAGG + Intergenic
1004620311 6:17325596-17325618 CTTTGTTAAGGCCTATGATGAGG + Intergenic
1005086298 6:22010306-22010328 CTGTGCACAGCTCTGGGATGTGG + Intergenic
1005290801 6:24376841-24376863 CTGGGTAAAACTCTCTAATGCGG - Intergenic
1007515877 6:42411064-42411086 GTGGGCAAAGCTCTATGATGGGG + Intronic
1007532834 6:42558085-42558107 CTGTGTAAGGCTCTCTACTGTGG - Intergenic
1008294399 6:49757711-49757733 CTGAGTGAAGTTCTAAGATGTGG + Intergenic
1009388042 6:63110968-63110990 CTGTGCAAAACTCAATGTTGTGG - Intergenic
1009409497 6:63349449-63349471 CTGTGAAAAGATTTGTGATGTGG + Intergenic
1011897040 6:92241383-92241405 CTGGGTAAATCTCCCTGATGAGG - Intergenic
1014653893 6:124074831-124074853 CTATGTAAAGTGCTATGATAAGG - Intronic
1019121042 6:169803836-169803858 CTGTGGAGAGCTCTCTGGTGTGG - Intergenic
1019121132 6:169804910-169804932 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121148 6:169805082-169805104 CTGTGAAGAGCTCAGTGATGTGG - Intergenic
1019121218 6:169805852-169805874 CTGTGGAGAGCCCTATGGTGAGG - Intergenic
1019121245 6:169806205-169806227 GTGTGTAGAGCTCTGTGGTGTGG - Intergenic
1019121252 6:169806309-169806331 CTGTGGAGAGCTCTGTGATATGG - Intergenic
1019121300 6:169806893-169806915 ATGTGGAGAGCTCTGTGATGTGG - Intergenic
1019121356 6:169807736-169807758 CTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1026146457 7:67750723-67750745 CTGTTTAGAGCTCTATGATCTGG + Intergenic
1028128057 7:87137285-87137307 CTGTGTAAAGCTCTTTAGTTAGG - Intergenic
1031059499 7:117034386-117034408 CTGTATGAAAATCTATGATGTGG + Intronic
1031140833 7:117941355-117941377 CTGTGTAAACCAATATGATAGGG - Intergenic
1032009297 7:128332223-128332245 CTCTGTGAATCTTTATGATGTGG + Intronic
1034584939 7:152081938-152081960 CTGTGTATTGCTCTATTGTGTGG + Intronic
1034866344 7:154645678-154645700 CTGTGAAACACTGTATGATGAGG + Intronic
1036004136 8:4642759-4642781 TTGGGTAATGCTTTATGATGAGG + Intronic
1036672570 8:10801884-10801906 CTGTGACAAGCTCTCTCATGGGG - Intronic
1039596024 8:38790405-38790427 CTGTTCAAAGCTCTCTGTTGTGG - Intronic
1040098062 8:43467450-43467472 CTATGAAAAACTCTATGATATGG - Intergenic
1041699754 8:60774847-60774869 ATGTGTAAAACACTATGCTGTGG - Intronic
1043182362 8:77101913-77101935 ATCTGTCAAGCTTTATGATGTGG + Intergenic
1047493194 8:125390748-125390770 CTGTGTTAAATGCTATGATGGGG - Intergenic
1047633125 8:126729833-126729855 CTGTGTAAAGCTCTTTTTTAAGG + Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1048398901 8:134044745-134044767 GTGTGTAGAGTTCTATGCTGGGG + Intergenic
1048527914 8:135221468-135221490 ATGTGAACAGCTCTGTGATGGGG + Intergenic
1049847516 8:144810298-144810320 GTGTGTCAAACTCCATGATGGGG + Intronic
1052427305 9:28322257-28322279 CAGTGAAAACCTCTCTGATGAGG - Intronic
1054343858 9:63894969-63894991 AAGTGTAAAGCTCTATAATTAGG + Intergenic
1055369141 9:75578102-75578124 TTGTGTAAAGCACAATGATGGGG - Intergenic
1203431927 Un_GL000195v1:99141-99163 CTTTGTAATGTTCTATAATGGGG - Intergenic
1203434576 Un_GL000195v1:125444-125466 CTTTGTAATGTTCTATAATGGGG + Intergenic
1186959637 X:14721935-14721957 CTGTGGAAAGCTGGAGGATGGGG - Intronic
1190744331 X:53312555-53312577 CTCTGTAAAGCTCTGTGCTGTGG - Intronic
1191958116 X:66668450-66668472 CTGAGCAAAGTTCTATGCTGTGG - Intergenic
1192298997 X:69880937-69880959 CTATGTAAATTTCAATGATGGGG - Intronic
1192606330 X:72522548-72522570 CTGTTTAAAACTCAATAATGTGG - Intronic
1195067711 X:101252692-101252714 GTGTGTAATACTCCATGATGGGG - Exonic
1200843447 Y:7807422-7807444 CTGTGTAAAACACTTGGATGTGG - Intergenic