ID: 1148883865

View in Genome Browser
Species Human (GRCh38)
Location 17:50757118-50757140
Sequence AGCCCTATGCTCATACTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148883865_1148883873 26 Left 1148883865 17:50757118-50757140 CCCCTCAGTATGAGCATAGGGCT No data
Right 1148883873 17:50757167-50757189 CCGAGTGCTCCTATGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148883865 Original CRISPR AGCCCTATGCTCATACTGAG GGG (reversed) Intergenic
No off target data available for this crispr