ID: 1148887936

View in Genome Browser
Species Human (GRCh38)
Location 17:50787043-50787065
Sequence CCTGGGATCCAGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148887936_1148887948 25 Left 1148887936 17:50787043-50787065 CCCTCCACAGTCTGGATCCCAGG No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data
1148887936_1148887944 10 Left 1148887936 17:50787043-50787065 CCCTCCACAGTCTGGATCCCAGG No data
Right 1148887944 17:50787076-50787098 ACGTGGTCCCCTCTCTCACTTGG No data
1148887936_1148887940 -7 Left 1148887936 17:50787043-50787065 CCCTCCACAGTCTGGATCCCAGG No data
Right 1148887940 17:50787059-50787081 TCCCAGGAGCTCCTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148887936 Original CRISPR CCTGGGATCCAGACTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr