ID: 1148887940

View in Genome Browser
Species Human (GRCh38)
Location 17:50787059-50787081
Sequence TCCCAGGAGCTCCTGCAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148887938_1148887940 -8 Left 1148887938 17:50787044-50787066 CCTCCACAGTCTGGATCCCAGGA No data
Right 1148887940 17:50787059-50787081 TCCCAGGAGCTCCTGCAACGTGG No data
1148887936_1148887940 -7 Left 1148887936 17:50787043-50787065 CCCTCCACAGTCTGGATCCCAGG No data
Right 1148887940 17:50787059-50787081 TCCCAGGAGCTCCTGCAACGTGG No data
1148887934_1148887940 19 Left 1148887934 17:50787017-50787039 CCTAAGTCTTGCAATGGTCTACA No data
Right 1148887940 17:50787059-50787081 TCCCAGGAGCTCCTGCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148887940 Original CRISPR TCCCAGGAGCTCCTGCAACG TGG Intergenic
No off target data available for this crispr