ID: 1148887944

View in Genome Browser
Species Human (GRCh38)
Location 17:50787076-50787098
Sequence ACGTGGTCCCCTCTCTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148887942_1148887944 -8 Left 1148887942 17:50787061-50787083 CCAGGAGCTCCTGCAACGTGGTC No data
Right 1148887944 17:50787076-50787098 ACGTGGTCCCCTCTCTCACTTGG No data
1148887938_1148887944 9 Left 1148887938 17:50787044-50787066 CCTCCACAGTCTGGATCCCAGGA No data
Right 1148887944 17:50787076-50787098 ACGTGGTCCCCTCTCTCACTTGG No data
1148887939_1148887944 6 Left 1148887939 17:50787047-50787069 CCACAGTCTGGATCCCAGGAGCT No data
Right 1148887944 17:50787076-50787098 ACGTGGTCCCCTCTCTCACTTGG No data
1148887936_1148887944 10 Left 1148887936 17:50787043-50787065 CCCTCCACAGTCTGGATCCCAGG No data
Right 1148887944 17:50787076-50787098 ACGTGGTCCCCTCTCTCACTTGG No data
1148887941_1148887944 -7 Left 1148887941 17:50787060-50787082 CCCAGGAGCTCCTGCAACGTGGT No data
Right 1148887944 17:50787076-50787098 ACGTGGTCCCCTCTCTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148887944 Original CRISPR ACGTGGTCCCCTCTCTCACT TGG Intergenic
No off target data available for this crispr