ID: 1148887948

View in Genome Browser
Species Human (GRCh38)
Location 17:50787091-50787113
Sequence TCACTTGGCTGTAGCCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148887938_1148887948 24 Left 1148887938 17:50787044-50787066 CCTCCACAGTCTGGATCCCAGGA No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data
1148887941_1148887948 8 Left 1148887941 17:50787060-50787082 CCCAGGAGCTCCTGCAACGTGGT No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data
1148887939_1148887948 21 Left 1148887939 17:50787047-50787069 CCACAGTCTGGATCCCAGGAGCT No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data
1148887942_1148887948 7 Left 1148887942 17:50787061-50787083 CCAGGAGCTCCTGCAACGTGGTC No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data
1148887936_1148887948 25 Left 1148887936 17:50787043-50787065 CCCTCCACAGTCTGGATCCCAGG No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data
1148887943_1148887948 -2 Left 1148887943 17:50787070-50787092 CCTGCAACGTGGTCCCCTCTCTC No data
Right 1148887948 17:50787091-50787113 TCACTTGGCTGTAGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148887948 Original CRISPR TCACTTGGCTGTAGCCCCAC TGG Intergenic
No off target data available for this crispr