ID: 1148890397

View in Genome Browser
Species Human (GRCh38)
Location 17:50802942-50802964
Sequence AGCCTCCTAGAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148890397_1148890401 -9 Left 1148890397 17:50802942-50802964 CCTTTCTCCTTCTCTAGGAGGCT No data
Right 1148890401 17:50802956-50802978 TAGGAGGCTGGCTGTGAGGCAGG No data
1148890397_1148890402 -6 Left 1148890397 17:50802942-50802964 CCTTTCTCCTTCTCTAGGAGGCT No data
Right 1148890402 17:50802959-50802981 GAGGCTGGCTGTGAGGCAGGAGG No data
1148890397_1148890404 -4 Left 1148890397 17:50802942-50802964 CCTTTCTCCTTCTCTAGGAGGCT No data
Right 1148890404 17:50802961-50802983 GGCTGGCTGTGAGGCAGGAGGGG No data
1148890397_1148890405 7 Left 1148890397 17:50802942-50802964 CCTTTCTCCTTCTCTAGGAGGCT No data
Right 1148890405 17:50802972-50802994 AGGCAGGAGGGGAAGAAAAAAGG No data
1148890397_1148890403 -5 Left 1148890397 17:50802942-50802964 CCTTTCTCCTTCTCTAGGAGGCT No data
Right 1148890403 17:50802960-50802982 AGGCTGGCTGTGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148890397 Original CRISPR AGCCTCCTAGAGAAGGAGAA AGG (reversed) Intergenic