ID: 1148891684

View in Genome Browser
Species Human (GRCh38)
Location 17:50812154-50812176
Sequence CACTGTAATCCCAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148891684_1148891690 9 Left 1148891684 17:50812154-50812176 CCTTCTGCCTTGGGATTACAGTG No data
Right 1148891690 17:50812186-50812208 CAGGCGTGAGCTGCCGCTCCTGG 0: 4
1: 129
2: 2181
3: 40306
4: 94982
1148891684_1148891688 -10 Left 1148891684 17:50812154-50812176 CCTTCTGCCTTGGGATTACAGTG No data
Right 1148891688 17:50812167-50812189 GATTACAGTGCTGGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148891684 Original CRISPR CACTGTAATCCCAAGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr