ID: 1148892317

View in Genome Browser
Species Human (GRCh38)
Location 17:50817184-50817206
Sequence TCAAGCCTTCACCACGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148892317_1148892324 7 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892324 17:50817214-50817236 GCTGTAGGGCTGACAGCCACGGG No data
1148892317_1148892321 -8 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892321 17:50817199-50817221 AGGCTTGAGGTGAGTGCTGTAGG No data
1148892317_1148892322 -7 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892322 17:50817200-50817222 GGCTTGAGGTGAGTGCTGTAGGG No data
1148892317_1148892325 8 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892325 17:50817215-50817237 CTGTAGGGCTGACAGCCACGGGG No data
1148892317_1148892326 17 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892326 17:50817224-50817246 TGACAGCCACGGGGTCATTACGG No data
1148892317_1148892323 6 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892323 17:50817213-50817235 TGCTGTAGGGCTGACAGCCACGG No data
1148892317_1148892327 18 Left 1148892317 17:50817184-50817206 CCCACACCGTGGTGAAGGCTTGA No data
Right 1148892327 17:50817225-50817247 GACAGCCACGGGGTCATTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148892317 Original CRISPR TCAAGCCTTCACCACGGTGT GGG (reversed) Intergenic