ID: 1148894327

View in Genome Browser
Species Human (GRCh38)
Location 17:50831265-50831287
Sequence GTGATTAGTCAGACTCAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148894327_1148894334 21 Left 1148894327 17:50831265-50831287 CCGGCTTGAGTCTGACTAATCAC No data
Right 1148894334 17:50831309-50831331 GGGCTGCCATCTGAGCACCCTGG No data
1148894327_1148894335 26 Left 1148894327 17:50831265-50831287 CCGGCTTGAGTCTGACTAATCAC No data
Right 1148894335 17:50831314-50831336 GCCATCTGAGCACCCTGGCTAGG No data
1148894327_1148894330 1 Left 1148894327 17:50831265-50831287 CCGGCTTGAGTCTGACTAATCAC No data
Right 1148894330 17:50831289-50831311 GCCTTTAGCCAAGGCAACCTGGG No data
1148894327_1148894328 -8 Left 1148894327 17:50831265-50831287 CCGGCTTGAGTCTGACTAATCAC No data
Right 1148894328 17:50831280-50831302 CTAATCACTGCCTTTAGCCAAGG No data
1148894327_1148894329 0 Left 1148894327 17:50831265-50831287 CCGGCTTGAGTCTGACTAATCAC No data
Right 1148894329 17:50831288-50831310 TGCCTTTAGCCAAGGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148894327 Original CRISPR GTGATTAGTCAGACTCAAGC CGG (reversed) Intergenic
No off target data available for this crispr