ID: 1148896102

View in Genome Browser
Species Human (GRCh38)
Location 17:50840098-50840120
Sequence GGGCGTTATAGATGACCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148896102_1148896113 27 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896113 17:50840148-50840170 GCACGGCCCGGAACGTGGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1148896102_1148896109 15 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896109 17:50840136-50840158 GGATCTACACCTGCACGGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 60
1148896102_1148896110 22 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896110 17:50840143-50840165 CACCTGCACGGCCCGGAACGTGG 0: 1
1: 0
2: 0
3: 8
4: 74
1148896102_1148896114 28 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896114 17:50840149-50840171 CACGGCCCGGAACGTGGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 93
1148896102_1148896105 -6 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896105 17:50840115-50840137 ACGCCCAGCTGCAGGATGCTGGG 0: 1
1: 1
2: 0
3: 14
4: 160
1148896102_1148896112 26 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896112 17:50840147-50840169 TGCACGGCCCGGAACGTGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 51
1148896102_1148896108 10 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896108 17:50840131-50840153 TGCTGGGATCTACACCTGCACGG 0: 1
1: 0
2: 2
3: 22
4: 209
1148896102_1148896104 -7 Left 1148896102 17:50840098-50840120 CCAGCTGGTCATCTATAACGCCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1148896104 17:50840114-50840136 AACGCCCAGCTGCAGGATGCTGG 0: 1
1: 0
2: 0
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148896102 Original CRISPR GGGCGTTATAGATGACCAGC TGG (reversed) Exonic
900706958 1:4086928-4086950 GGGCATCACAGATGACCAGGAGG - Intergenic
902248032 1:15134595-15134617 GGGCATTATAGATTACCATAAGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905877328 1:41440863-41440885 AGGAGTTTTAAATGACCAGCTGG - Intergenic
919309998 1:195895096-195895118 GGGCATTCTGGATAACCAGCTGG + Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
923888411 1:238183490-238183512 GGGAGTTATAGATGAGCTGGTGG + Intergenic
1076032354 10:127170296-127170318 GGCCCTTAAACATGACCAGCAGG - Intronic
1083502139 11:63119277-63119299 AGGTGTTAGAGATGGCCAGCTGG + Exonic
1088848160 11:113684683-113684705 GGGCCTTAATGAGGACCAGCTGG - Intergenic
1107554120 13:41502518-41502540 GGGCGTTATAAATAACCATAAGG + Intergenic
1115370031 14:32602920-32602942 AGGCGTTAGAGATGAACAGCTGG + Intronic
1130486929 15:84403287-84403309 GGGCTTTGTGGATGCCCAGCTGG - Intergenic
1134677560 16:16101335-16101357 GGGCTTTATAAATGAGCAGGTGG - Intronic
1148896102 17:50840098-50840120 GGGCGTTATAGATGACCAGCTGG - Exonic
1153159720 18:2190163-2190185 GGGAGTTATAGAAGCCCAGCTGG - Intergenic
1179978995 21:44886807-44886829 GAGCCTTCCAGATGACCAGCAGG + Exonic
961215825 3:125159781-125159803 TGGGGTTCTAGATGACCAGAGGG - Intronic
971537631 4:27773448-27773470 GGAAGTCATAGATGACAAGCAGG + Intergenic
981298552 4:143160793-143160815 GGGCGACACAGAGGACCAGCTGG - Intergenic
985543525 5:497945-497967 AGGCTTCATAGCTGACCAGCAGG - Intronic
995377299 5:111489874-111489896 GGGCTTTAGAGATGACCATAGGG - Exonic
996279302 5:121708844-121708866 GGGAGTTATAGAAGACAAGTGGG - Intergenic
999805627 5:155078530-155078552 GGGTGTTATTTGTGACCAGCTGG + Intergenic
1018361047 6:163068616-163068638 AGGCATTATAGATGACTGGCTGG - Intronic
1032355859 7:131209968-131209990 GGGTAGTATAGATGAGCAGCTGG + Intronic
1035257128 7:157637582-157637604 GGGCTTTGTAGGTGACCATCAGG - Intronic
1050364647 9:4863054-4863076 GGGCCTTGTAGATGACAAGAAGG - Intronic
1190889982 X:54559388-54559410 GGGCGGTCTGGATGACTAGCGGG - Intronic
1194599037 X:95897436-95897458 GTGCATTATAGGAGACCAGCTGG + Intergenic
1195492224 X:105484365-105484387 AAGTGTTATAGATGTCCAGCTGG + Exonic