ID: 1148897107

View in Genome Browser
Species Human (GRCh38)
Location 17:50845410-50845432
Sequence CTGGATCAGCACAAACACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148897107_1148897110 -3 Left 1148897107 17:50845410-50845432 CCTCTGTGTTTGTGCTGATCCAG No data
Right 1148897110 17:50845430-50845452 CAGATCAGAATCATTGCCTAGGG No data
1148897107_1148897113 14 Left 1148897107 17:50845410-50845432 CCTCTGTGTTTGTGCTGATCCAG No data
Right 1148897113 17:50845447-50845469 CTAGGGCCTCCAGGAAGCTGTGG No data
1148897107_1148897109 -4 Left 1148897107 17:50845410-50845432 CCTCTGTGTTTGTGCTGATCCAG No data
Right 1148897109 17:50845429-50845451 CCAGATCAGAATCATTGCCTAGG No data
1148897107_1148897111 5 Left 1148897107 17:50845410-50845432 CCTCTGTGTTTGTGCTGATCCAG No data
Right 1148897111 17:50845438-50845460 AATCATTGCCTAGGGCCTCCAGG No data
1148897107_1148897114 15 Left 1148897107 17:50845410-50845432 CCTCTGTGTTTGTGCTGATCCAG No data
Right 1148897114 17:50845448-50845470 TAGGGCCTCCAGGAAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148897107 Original CRISPR CTGGATCAGCACAAACACAG AGG (reversed) Intergenic
No off target data available for this crispr