ID: 1148898713

View in Genome Browser
Species Human (GRCh38)
Location 17:50858231-50858253
Sequence CTGGGTCAGGGGGAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148898713_1148898723 -10 Left 1148898713 17:50858231-50858253 CCATCCCCCTCCCCCTGACCCAG No data
Right 1148898723 17:50858244-50858266 CCTGACCCAGTCTATAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148898713 Original CRISPR CTGGGTCAGGGGGAGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr