ID: 1148899710

View in Genome Browser
Species Human (GRCh38)
Location 17:50866520-50866542
Sequence GGCCAATGGCGTCGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148899710_1148899718 0 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899718 17:50866543-50866565 AAGTCCCGCCTGCCCCTGTCCGG 0: 1
1: 0
2: 0
3: 7
4: 100
1148899710_1148899723 11 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899723 17:50866554-50866576 GCCCCTGTCCGGACGCGCGGCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1148899710_1148899722 8 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899722 17:50866551-50866573 CCTGCCCCTGTCCGGACGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 64
1148899710_1148899731 23 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899731 17:50866566-50866588 ACGCGCGGCGGACGCAGGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 143
1148899710_1148899727 18 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899727 17:50866561-50866583 TCCGGACGCGCGGCGGACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 59
1148899710_1148899730 20 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899730 17:50866563-50866585 CGGACGCGCGGCGGACGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 89
1148899710_1148899733 25 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899733 17:50866568-50866590 GCGCGGCGGACGCAGGGGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 260
1148899710_1148899732 24 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899732 17:50866567-50866589 CGCGCGGCGGACGCAGGGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 132
1148899710_1148899729 19 Left 1148899710 17:50866520-50866542 CCTGCCCCCCGACGCCATTGGCC 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1148899729 17:50866562-50866584 CCGGACGCGCGGCGGACGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148899710 Original CRISPR GGCCAATGGCGTCGGGGGGC AGG (reversed) Intronic
900991544 1:6100465-6100487 GGCCAATGGTGCCAGAGGGCAGG + Exonic
901332659 1:8423414-8423436 GGCGAGTGGCGTCGGGAGGGCGG - Intronic
904128560 1:28259622-28259644 GGCGAACGGCCTCGGGGGCCTGG - Exonic
910759118 1:90718054-90718076 GGCCAATAGGGGCGCGGGGCCGG - Intergenic
916107228 1:161441054-161441076 TGCCAACGGTGGCGGGGGGCGGG - Intergenic
916108815 1:161448472-161448494 TGCCAACGGTGGCGGGGGGCGGG - Intergenic
916110403 1:161455853-161455875 TGCCAACGGTGGCGGGGGGCGGG - Intergenic
916111988 1:161463263-161463285 TGCCAACGGTGGCGGGGGGCGGG - Intergenic
916113575 1:161470644-161470666 TGCCAACGGTGGCGGGGGGCGGG - Intergenic
917967066 1:180185555-180185577 GGGAAATGGCGACTGGGGGCAGG - Intronic
924688890 1:246325201-246325223 GGGAAAAGGAGTCGGGGGGCGGG + Intronic
1063389624 10:5640762-5640784 GGCCACTGGCGTCCGAGGGCTGG - Exonic
1066337602 10:34495023-34495045 GGCAAATTGGGTTGGGGGGCTGG - Intronic
1067139911 10:43648485-43648507 GGCCCATGGCGTCGGGGCGTGGG - Intronic
1072706887 10:97687326-97687348 GGCCAGCGGAGGCGGGGGGCGGG - Intergenic
1073184843 10:101609697-101609719 GGCCAGTGGGGTCTGGGGCCAGG - Intergenic
1073465649 10:103693264-103693286 GGCGAATCGCGCCTGGGGGCCGG - Intronic
1075438486 10:122461732-122461754 GGCCAAAGGCGCCGAGCGGCCGG - Exonic
1076893763 10:133298601-133298623 GGCCACTGGCGCAGGAGGGCAGG - Intronic
1077153999 11:1083474-1083496 GGCCATTGGCGTCCGGCTGCAGG + Intergenic
1077298755 11:1837804-1837826 GGGCAATGGTGTCTGGGGGCTGG + Intergenic
1083740923 11:64711490-64711512 GGGCTGTGGTGTCGGGGGGCAGG - Intronic
1083765890 11:64841559-64841581 GGCCTATGGCGCGGGGGGGGCGG - Intronic
1083880623 11:65546688-65546710 GGTGATTGGCGTCTGGGGGCGGG - Intronic
1083901983 11:65647626-65647648 GGCCGCTCTCGTCGGGGGGCAGG - Exonic
1083939505 11:65888160-65888182 GGCCTCTGGCGTCGGCGGGGCGG - Intronic
1085777270 11:79378270-79378292 GGCCAATGGAGTAGGGGGCCTGG + Intronic
1090653266 11:128824720-128824742 GGCCGAGGGCGTTGGGGGCCGGG + Intergenic
1092046344 12:5433715-5433737 GGCCTCTGGCGGCGGGCGGCAGG + Intronic
1097185216 12:57193053-57193075 GGCAAAAGGCTTTGGGGGGCTGG - Intronic
1100906398 12:99305055-99305077 GGCCAAGGGCGGTGGGGGGCAGG + Intronic
1103927666 12:124432847-124432869 AGCAAGTGGCGGCGGGGGGCGGG + Intronic
1103952257 12:124557712-124557734 GGCAGATGGCGTGGGTGGGCGGG + Intronic
1107057883 13:36126510-36126532 GGCCAAAGGGGTTGGGGGGCGGG - Intronic
1116917810 14:50542273-50542295 GGCCTGTGGTGTCGGGGGGAGGG + Intronic
1118292921 14:64541965-64541987 GGCCTATGGCGCCGCGGTGCAGG + Exonic
1121137190 14:91509852-91509874 GGACAATAGCGCCGGGGAGCCGG - Exonic
1122864908 14:104599310-104599332 GGGCAATGGGGTGGGAGGGCGGG + Intronic
1129070470 15:72946357-72946379 GGGCAAAGGCTTCGGTGGGCAGG - Intergenic
1129313162 15:74726074-74726096 GGCCAGAGGCGCCGCGGGGCTGG + Intergenic
1129716946 15:77857730-77857752 GGAGTATGGGGTCGGGGGGCAGG + Intergenic
1129755033 15:78092875-78092897 GGCCCTTGGAGGCGGGGGGCAGG + Intronic
1130139253 15:81209768-81209790 GGCCACTGGCGAGGGGAGGCAGG - Intronic
1131493433 15:92882599-92882621 AGCCAATGGCCGCGGCGGGCGGG + Intergenic
1131827067 15:96330547-96330569 GGCCAATGACGGCGAGGGGGCGG + Intronic
1132560179 16:590003-590025 GGCCAATGGGCTCGGGAGGGCGG + Intronic
1134107463 16:11494386-11494408 GGGCAGTGGCGTGGGGGGGCAGG + Intronic
1134490179 16:14690496-14690518 AGTCAATGGCATCGCGGGGCTGG + Exonic
1134495560 16:14729613-14729635 AGTCAATGGCATCGCGGGGCTGG + Intronic
1134501111 16:14769926-14769948 AGTCAATGGCATCGCGGGGCTGG + Intronic
1134579471 16:15359106-15359128 AGTCAATGGCATCGCGGGGCTGG - Intergenic
1134723112 16:16398445-16398467 AGTCAATGGCATCGCGGGGCTGG + Intergenic
1134944316 16:18313425-18313447 AGTCAATGGCATCGCGGGGCTGG - Intergenic
1138532930 16:57645110-57645132 GGCCCAGGGGGTCGGGCGGCAGG - Intronic
1139420159 16:66844867-66844889 GGCCCAGGGCAGCGGGGGGCGGG + Intronic
1139431206 16:66911909-66911931 GGCTGATGGGGTCGGAGGGCTGG + Exonic
1141527005 16:84618120-84618142 GGCCAATGGGCGCGGGGGGGCGG - Intergenic
1142080073 16:88144197-88144219 GGCCAAAGGCGTGGTGGGGAGGG + Intergenic
1142473052 17:173728-173750 GGCCAATGGCAAAGAGGGGCTGG + Intronic
1142711224 17:1724962-1724984 GGCCCAGGGCAGCGGGGGGCGGG + Exonic
1142762870 17:2051673-2051695 GGGCTGTGGCGTCGGGGGCCGGG + Intergenic
1143483934 17:7242562-7242584 CGCTAATGGCGTGAGGGGGCCGG - Exonic
1143712627 17:8744890-8744912 GACCAATGGGGGCAGGGGGCAGG - Intronic
1144586736 17:16491911-16491933 GGCCGTTCGCGTCGGGGGCCCGG + Exonic
1144656786 17:17042293-17042315 GGCCAATGGCAGTCGGGGGCGGG - Intergenic
1144704482 17:17358216-17358238 GGCCAATGGTGGGAGGGGGCTGG + Intergenic
1146496357 17:33325881-33325903 GGCCAGTGCAGTTGGGGGGCTGG + Intronic
1147325596 17:39668070-39668092 GGTGAATGGCTGCGGGGGGCTGG + Intronic
1147896616 17:43755623-43755645 GGCCGATGGCGTTGGGCAGCAGG + Exonic
1148081118 17:44968132-44968154 GGGCAATGGTGCCGGCGGGCAGG + Intergenic
1148092539 17:45031223-45031245 GGACAATGGCGGTGGGGGGGTGG + Intronic
1148899710 17:50866520-50866542 GGCCAATGGCGTCGGGGGGCAGG - Intronic
1149512906 17:57257217-57257239 AGCCAATGGCGGGGGGGGGGGGG - Intronic
1149888926 17:60368511-60368533 GGCCATTGCGGTTGGGGGGCGGG + Intronic
1150823915 17:68457677-68457699 GGCCAATGGTGGCCGGAGGCAGG - Intergenic
1151780239 17:76240534-76240556 AGCCAATGGCGAGGCGGGGCGGG + Intergenic
1152778924 17:82217939-82217961 GGCCTATGGGGCCGGGGGCCTGG - Intergenic
1153975467 18:10264888-10264910 CGCCAATGGTGTGGGGGAGCAGG + Intergenic
1158265026 18:55652176-55652198 GGCAAATGGCATCAGGGGTCAGG + Intronic
1158640356 18:59198189-59198211 GGCCAAAGGTGGCAGGGGGCTGG + Intergenic
1160753753 19:747430-747452 GGACAATGGAGTCTGGGGGAGGG + Exonic
1160905501 19:1450017-1450039 AGCCAATGGCGGCCCGGGGCGGG - Intronic
1161285358 19:3465715-3465737 GGTGAATGGTGTCTGGGGGCCGG - Intronic
1161487587 19:4544074-4544096 GGCCCAGGGCGTGGGGGTGCGGG + Exonic
1162721746 19:12666776-12666798 GGCCAATCGGGGTGGGGGGCGGG + Intronic
1162926809 19:13934349-13934371 CGCGGAAGGCGTCGGGGGGCAGG + Exonic
1163151743 19:15419031-15419053 AGCCAATGCGGTCGGGAGGCGGG - Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163573540 19:18097714-18097736 GGCCAATGGCACCTGGCGGCGGG + Intronic
1163665853 19:18603885-18603907 GGCCGAGGGGGGCGGGGGGCTGG + Intronic
1165780867 19:38433629-38433651 GTCCAATGGGGCCCGGGGGCGGG + Intergenic
1167154586 19:47730281-47730303 GGCCAATGGAGCCAGGGGGCAGG - Intronic
1167751030 19:51380363-51380385 GGCCTATGGAGTCTGGGGTCGGG - Intronic
1168078448 19:53992814-53992836 GGCGAAGGGCCTCGAGGGGCGGG - Exonic
1168528205 19:57105630-57105652 GGCTAATGTTGGCGGGGGGCGGG + Intergenic
926599894 2:14830998-14831020 GGGCAATGGTGTCCTGGGGCTGG - Intergenic
926715590 2:15921423-15921445 GGCCAATGGTGTGGGTGGGGTGG + Intergenic
927472611 2:23386609-23386631 CCCCGATGGCCTCGGGGGGCCGG + Intronic
927881501 2:26692834-26692856 GGCCGGGGGCGCCGGGGGGCCGG + Exonic
928927913 2:36597678-36597700 GGCTCGTGGCGGCGGGGGGCAGG + Intronic
931487207 2:62705665-62705687 GGCCAATGGCGGCGGGGCGGTGG + Intronic
936072776 2:109382445-109382467 GGCCAACCACGTCGGGGGTCAGG - Intronic
937083762 2:119157873-119157895 GGCCAGCGGCGTCGGGGTGGTGG - Exonic
937448202 2:121976138-121976160 GGACAATGGCCTCTGGGCGCGGG + Intergenic
937933027 2:127220117-127220139 GGACAAAGGCGCCGGGCGGCCGG - Intergenic
940848857 2:158669748-158669770 GGCCATTGCCGCCGGGGAGCCGG - Exonic
940986777 2:160058830-160058852 GGCCAATGGGGTGGTGGGGTGGG + Intronic
943639719 2:190344254-190344276 GCCCGATGGGGTTGGGGGGCGGG + Intronic
945214833 2:207422161-207422183 GGGAAGTGGGGTCGGGGGGCAGG + Intergenic
948444637 2:238022830-238022852 GGCCACTGGGGTTGGGGGGAAGG + Intronic
948456183 2:238105667-238105689 GGCCCATGGGGCCCGGGGGCGGG + Intronic
948473948 2:238204257-238204279 GGCCACTGACATCGGGGAGCTGG + Intergenic
948809152 2:240466136-240466158 GGTCAAGGGCGTCCGGGAGCTGG - Exonic
1168805604 20:670639-670661 GGCAAAGGGCAGCGGGGGGCAGG - Intronic
1175074095 20:56359097-56359119 GGCCAGGGGCGGCGGGGCGCAGG - Exonic
1175242626 20:57561010-57561032 CGCCACTGACGTCAGGGGGCAGG - Intergenic
1175381896 20:58569355-58569377 TGCCCATGCCGTCGGGGTGCTGG + Intergenic
1176029663 20:63005865-63005887 CGCCAAGGCCGTCGGGGCGCGGG - Intergenic
1176062559 20:63178775-63178797 CGCCTCTGGCGTCGCGGGGCGGG + Intergenic
1179906586 21:44426110-44426132 GGGGAATGGGGCCGGGGGGCTGG - Intronic
1179958022 21:44751886-44751908 GGCCAATGGCTTGGAGGGGGCGG - Intergenic
1181573181 22:23778899-23778921 GGCCAATGAGGTCTGGGGGTGGG - Intronic
1181725231 22:24806565-24806587 GGCCTCTGGCGGCGGGGGGGCGG + Intronic
1182494194 22:30694858-30694880 GGCCAGTGGGGGCGGGGGGCAGG - Exonic
1182805214 22:33064064-33064086 GGCCAAGGGCATCGGAGGCCAGG - Intergenic
1184265387 22:43343423-43343445 GGCCCGTGGCGTCGGAGGGGCGG + Intergenic
953618219 3:44510720-44510742 GGCCGCTGGCGGCGGGCGGCGGG + Intergenic
960876508 3:122300949-122300971 GGCCAAGGCAGGCGGGGGGCAGG - Intergenic
961818166 3:129561770-129561792 GGGAAATGGGGGCGGGGGGCAGG + Intronic
965596771 3:170418761-170418783 GGCCAATCGCGGGGCGGGGCCGG - Intergenic
968872411 4:3248594-3248616 GGCCCAGGGCGCCTGGGGGCTGG + Exonic
969230481 4:5826933-5826955 GGCCCAGGGAGTCGGGGAGCAGG - Intronic
973309071 4:48687480-48687502 GGCAAATGAGGTCGGGGGGGGGG + Intronic
980890567 4:138810389-138810411 GGCCAAGGGCGGGGGGAGGCGGG + Intergenic
983229213 4:165112756-165112778 GGGAAATGGCGGCGGGGGGCAGG - Exonic
997568152 5:134905135-134905157 GGCCAATGGCGGCGGTGCTCGGG + Exonic
997773385 5:136575226-136575248 GGACAATGGCGTAGTGGTGCAGG + Intergenic
999462938 5:151772275-151772297 GTCCAACGGCCTCGCGGGGCAGG + Intronic
1001509685 5:172311201-172311223 GGCCAAGGGCGGGGGGTGGCAGG + Intergenic
1002033543 5:176448252-176448274 GGCCAGAGGTGGCGGGGGGCGGG + Intronic
1002575038 5:180169782-180169804 GCCCCATGGGGTCGGGGGGTGGG - Intronic
1002591119 5:180292133-180292155 GGCCAATGGCGCCTGGGGGGCGG + Intergenic
1005398742 6:25410082-25410104 GCCATATGGCGGCGGGGGGCGGG - Intronic
1018774317 6:166999263-166999285 GCCCCCTGGCGTCGGGAGGCGGG - Exonic
1019531253 7:1504501-1504523 GCCCCATGGCGGCGGGAGGCGGG + Intergenic
1020596507 7:10213565-10213587 GGTGCATGGCGTCGGGGGGATGG + Intergenic
1023976892 7:45037160-45037182 TGACAATGGCGGCGGGGGGTGGG - Intronic
1024080803 7:45853580-45853602 GGCCAGTGGGGTCGGAGGGAGGG + Intergenic
1025089648 7:56051707-56051729 GCCCAATGGCGGCGGCGCGCGGG + Exonic
1029417139 7:100450419-100450441 GGCTAATGTCGTAGGGGTGCTGG + Intergenic
1029686141 7:102149487-102149509 GGGCAATGGCGTAGTGGCGCTGG - Intronic
1029732612 7:102447889-102447911 GGCCAGTGGCTGCGGGGGGTGGG - Exonic
1031922032 7:127609199-127609221 GGCCAAGGTGGTAGGGGGGCTGG + Intergenic
1032151600 7:129434328-129434350 AGCCAATCGCCTCGCGGGGCGGG + Intronic
1033646478 7:143308774-143308796 GGGCAAGGGGGTTGGGGGGCGGG - Intergenic
1034971855 7:155424234-155424256 GGCAAATGGGGTGGGGGGGCAGG - Intergenic
1037811548 8:22089632-22089654 GGCCTAGGGCCCCGGGGGGCAGG - Intronic
1037928263 8:22862166-22862188 GGCCACAGGAGTCGGGGGCCTGG + Intronic
1040901011 8:52417128-52417150 GGCCAATGTCTTCCGGGAGCAGG + Intronic
1042560870 8:70071363-70071385 GGCCAATGGCTGCGGTGGGCGGG - Intronic
1047951489 8:129939439-129939461 GGCCCGGGGCGTCGCGGGGCCGG + Intronic
1057209203 9:93190517-93190539 GGCAAATGGCATGTGGGGGCTGG - Intronic
1057466196 9:95317006-95317028 GGCGAATGGGGTTTGGGGGCAGG + Intronic
1057781814 9:98056618-98056640 AGCCAATCGGGGCGGGGGGCGGG - Intergenic
1061276575 9:129572306-129572328 GTGGAATGGGGTCGGGGGGCGGG - Intergenic
1062474589 9:136720751-136720773 GGGCACTGGCCTCGGAGGGCTGG + Intronic
1188662505 X:32776549-32776571 GGGCAGTGGGGTCGGGGGGAAGG + Intronic
1197870444 X:131058453-131058475 GGCCCACCGAGTCGGGGGGCTGG + Intronic