ID: 1148899849

View in Genome Browser
Species Human (GRCh38)
Location 17:50867032-50867054
Sequence CCAAAGACGTGGAGCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148899837_1148899849 17 Left 1148899837 17:50866992-50867014 CCTAGGCCAACCGCCACCCAGAG 0: 1
1: 0
2: 1
3: 11
4: 211
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899839_1148899849 11 Left 1148899839 17:50866998-50867020 CCAACCGCCACCCAGAGAGTGGC 0: 1
1: 0
2: 2
3: 16
4: 154
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899841_1148899849 4 Left 1148899841 17:50867005-50867027 CCACCCAGAGAGTGGCAGCTGCA 0: 1
1: 0
2: 3
3: 34
4: 232
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899840_1148899849 7 Left 1148899840 17:50867002-50867024 CCGCCACCCAGAGAGTGGCAGCT 0: 1
1: 0
2: 4
3: 29
4: 257
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899834_1148899849 25 Left 1148899834 17:50866984-50867006 CCCCAAGGCCTAGGCCAACCGCC 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899843_1148899849 0 Left 1148899843 17:50867009-50867031 CCAGAGAGTGGCAGCTGCAGAAC 0: 1
1: 0
2: 4
3: 37
4: 235
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899842_1148899849 1 Left 1148899842 17:50867008-50867030 CCCAGAGAGTGGCAGCTGCAGAA 0: 1
1: 0
2: 2
3: 34
4: 354
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899836_1148899849 23 Left 1148899836 17:50866986-50867008 CCAAGGCCTAGGCCAACCGCCAC 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135
1148899835_1148899849 24 Left 1148899835 17:50866985-50867007 CCCAAGGCCTAGGCCAACCGCCA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148899849 Original CRISPR CCAAAGACGTGGAGCCGGGC TGG Intronic
901174887 1:7291739-7291761 CCAATGGAGTGGAGCCAGGCTGG - Intronic
901652395 1:10750562-10750584 CCAGAGAAGTGAAGCAGGGCTGG - Intronic
902817198 1:18923068-18923090 CCAAAGCCGCTGAGCAGGGCAGG + Intronic
902973962 1:20075290-20075312 CCAAAGAGATGGAGCTGGGTAGG - Intronic
903035712 1:20491380-20491402 CCAATGGCATGGGGCCGGGCAGG + Intergenic
907873815 1:58466510-58466532 CCAAGGACTTGGAGCCTGGAAGG + Intronic
908983857 1:69992675-69992697 CCACAGACTTGGAGCTGAGCAGG + Intronic
913201014 1:116495434-116495456 CCAAACATGGGGAGACGGGCTGG + Intergenic
913677976 1:121160145-121160167 CCACATATGTGGAGCCAGGCAGG + Intergenic
914755877 1:150561396-150561418 CCAGGGCCCTGGAGCCGGGCCGG - Intergenic
915627734 1:157125876-157125898 CCAATGATGTGCAGCCGGGACGG - Exonic
917506383 1:175630864-175630886 CCAAACAAGGGGAGCAGGGCAGG + Intronic
924948550 1:248862773-248862795 GCAAATACCTGGAGCTGGGCTGG - Intergenic
1063099384 10:2936130-2936152 CTAAAGAAGCGGAGCGGGGCAGG + Intergenic
1066031859 10:31435730-31435752 CCAAAAATGTGGAGCCTTGCAGG + Intronic
1068964069 10:62894363-62894385 CCTCAGGCGTGGAGCTGGGCCGG - Intronic
1072332011 10:94363118-94363140 CCAAAGGCGGGAAGCCGGGCGGG + Intergenic
1074136814 10:110634910-110634932 CAAGAGACGTGGAGCCAGACGGG - Intergenic
1076373205 10:129967836-129967858 CCAGAGACGGGGACCTGGGCTGG + Intergenic
1076635559 10:131880108-131880130 CCAAAGCCCTGGAGGCAGGCAGG + Intergenic
1081171161 11:39871515-39871537 CTAAAGACATGGAGAGGGGCTGG + Intergenic
1083801323 11:65047966-65047988 CCAAAGAGGTGGAAGGGGGCAGG - Exonic
1091636545 12:2201421-2201443 CCTAAGAGGAGGAGCCAGGCTGG - Intronic
1095958354 12:47819243-47819265 CCCATCCCGTGGAGCCGGGCAGG - Intronic
1101644278 12:106614453-106614475 CAAAAGACGTGAAGAAGGGCCGG - Intronic
1103522389 12:121544959-121544981 CAAAAGTCCTGGAGCCGGGTGGG + Intronic
1103604695 12:122078378-122078400 CCCACCACGTGGAGCCGGCCGGG + Intergenic
1103649351 12:122421656-122421678 CCAAAGAGGTGGGGCTGTGCAGG + Intronic
1106318613 13:28617884-28617906 CCAAAGAGTTGGAGCAGGACTGG - Intergenic
1108579834 13:51819023-51819045 CCTAAGACTTGCAGCCCGGCTGG + Intergenic
1109238828 13:59857921-59857943 CCAAAGAAGGGGAGCCAAGCAGG + Intronic
1112427315 13:99314825-99314847 CCACAGACCTGGAGCCCAGCAGG - Intronic
1121888019 14:97562411-97562433 CACAAGACATGGAGCAGGGCAGG + Intergenic
1122605904 14:102947578-102947600 ACAAGGACCTGGAGCCAGGCTGG + Intronic
1128325032 15:66718750-66718772 CCAAAGACATGGGGCTGTGCTGG + Intronic
1129823722 15:78620887-78620909 CCCCAGACCTGGAGCCGTGCGGG + Exonic
1130870180 15:87965381-87965403 CCACAGATGGGGAGCCGGGAAGG + Intronic
1130957542 15:88638369-88638391 CCAAGGAAGTGTGGCCGGGCTGG + Intronic
1132561696 16:597784-597806 CCAAAGATGCTGAGCTGGGCTGG - Intronic
1132880842 16:2161088-2161110 CCAGGGACATGGAGGCGGGCGGG - Intronic
1136046656 16:27620487-27620509 AGAAAGTGGTGGAGCCGGGCTGG + Intronic
1137800721 16:51259779-51259801 CCAAAGGCGGGGAGGTGGGCAGG - Intergenic
1139853219 16:69962800-69962822 CCTGAGAAGTGGAGCAGGGCTGG + Intronic
1139882190 16:70185708-70185730 CCTGAGAAGTGGAGCAGGGCTGG + Intronic
1140370319 16:74409796-74409818 CCTGAGAAGTGGAGCAGGGCTGG - Intronic
1140468560 16:75201446-75201468 CCAAAGCCCTGGAGCTGGGTCGG - Intergenic
1141261970 16:82462492-82462514 CCAAAGGCGAGGAACAGGGCAGG + Intergenic
1142514413 17:417779-417801 CCTAGAACGTGGAGCAGGGCAGG + Intronic
1142514424 17:417840-417862 CCTAGAACGTGGAGCGGGGCAGG + Intronic
1142514435 17:417908-417930 CCTAGAACGTGGAGCGGGGCAGG + Intronic
1143593645 17:7901076-7901098 CCACAGGGGTGGAGCTGGGCTGG + Intronic
1144930854 17:18857992-18858014 CCACAGGGGTGGAGTCGGGCTGG - Intronic
1145122927 17:20277011-20277033 CCAAAGACCTGGAGCAGATCTGG + Intronic
1145900437 17:28487563-28487585 CCAGAGACAAGGAGCAGGGCTGG - Intronic
1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG + Intronic
1150960080 17:69903090-69903112 CCAAAGAAGTGAACCGGGGCCGG - Intergenic
1152409886 17:80117922-80117944 ACAAAGGCGTGGAGCATGGCCGG + Intergenic
1152514940 17:80817609-80817631 CAAATGACAGGGAGCCGGGCAGG + Intronic
1156458479 18:37307911-37307933 CCAACAACATGGAGCTGGGCAGG + Intronic
1160706194 19:531410-531432 CCAAAGCCGGGGGACCGGGCCGG + Intergenic
1161383798 19:3980446-3980468 CCCAAGACTTGGAGCAGGGCAGG + Intronic
1162145020 19:8608264-8608286 TCAAAGAGGAGGAGCCGGGCTGG + Exonic
1163051503 19:14688150-14688172 ACAAAGAAGTTGGGCCGGGCGGG - Intronic
1163414929 19:17180711-17180733 CCCAAGCCCTGGAGCGGGGCAGG - Intronic
1163504801 19:17699253-17699275 TAAAAGAGGTGGAGCCAGGCAGG + Intergenic
1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG + Exonic
1165361182 19:35337971-35337993 CCAATGACGTGGGCCCGGGAAGG + Exonic
1167535537 19:50048829-50048851 GCAAAGACGTGAGGCCTGGCAGG - Intronic
927199279 2:20568392-20568414 CCTAGGAGCTGGAGCCGGGCGGG + Intronic
934562439 2:95320341-95320363 GCAAAGAAGGGGTGCCGGGCTGG - Intronic
937984132 2:127630984-127631006 GCAATGAGGTGGAGCGGGGCTGG - Intronic
938114902 2:128596309-128596331 CCAAGGAGGTGGAGCCTGCCGGG - Intergenic
938380329 2:130832786-130832808 CCGAAGAGGTGGAGCCAGGCAGG - Intergenic
940360316 2:152789933-152789955 TCAAAGAAGTGCGGCCGGGCGGG + Intergenic
1172008699 20:31834090-31834112 TCAAAGACGAGGAGCTGGGGAGG - Exonic
1172835076 20:37868201-37868223 CCAAAGACTAGGGGCCAGGCAGG + Intronic
1173022487 20:39278610-39278632 CCAAAACCGTGGAGAAGGGCAGG + Intergenic
1175403656 20:58714124-58714146 CCACATGGGTGGAGCCGGGCAGG + Intronic
1176548468 21:8211893-8211915 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1176556362 21:8256101-8256123 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1176567399 21:8394928-8394950 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1176575301 21:8439143-8439165 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1177318324 21:19490163-19490185 CCAAAGAAGTCCAACCGGGCAGG + Intergenic
1178918635 21:36723748-36723770 GCAGAGACGTGGAGCCAGGGAGG - Intronic
1179896254 21:44365379-44365401 CCAAAGAGGTTGAGTGGGGCAGG + Intronic
1180034183 21:45234855-45234877 CCAGAGTCCTGCAGCCGGGCTGG - Intergenic
1180186992 21:46145088-46145110 CCACAGACCTGGAGCAAGGCAGG - Intronic
1181528754 22:23504134-23504156 CCAGAGAAGTGGAGATGGGCTGG - Intergenic
1183326488 22:37197363-37197385 CCGAAGGCTTGGAGCCAGGCAGG - Intronic
1184266015 22:43346506-43346528 GCACAGACGTGGAGGTGGGCAGG - Intergenic
1185367951 22:50445568-50445590 CCACAGACGTGGAACAGGGAGGG + Exonic
1203253352 22_KI270733v1_random:128198-128220 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1203261406 22_KI270733v1_random:173276-173298 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
950772527 3:15323691-15323713 CCAAAGCCGTGGGGAAGGGCAGG - Intronic
951054814 3:18135502-18135524 CCACAGACCTGGTGCAGGGCAGG - Intronic
954148128 3:48644308-48644330 CCAGACATGTGGGGCCGGGCAGG + Intronic
954411029 3:50371172-50371194 CTAAGGGCGTGGAGACGGGCTGG + Intronic
959748640 3:109807431-109807453 CCAGAGAAGAGGAGCCAGGCTGG + Intergenic
960062890 3:113341240-113341262 CGAAAGGCGTGGTCCCGGGCTGG - Intronic
961265563 3:125639374-125639396 GCAAAGACTTGGAGTCAGGCTGG + Intergenic
961626134 3:128264934-128264956 TGAAAGACTTGGAGCCGGGCGGG - Intronic
962746302 3:138399728-138399750 CCAAAGGCGGGGAGCAGGGTGGG - Intronic
966940303 3:184741872-184741894 CCCAAGACGTGAAGCCAGGTTGG + Intergenic
967088136 3:186112285-186112307 CAAAAGAAGAGGAGCCGGGGAGG - Intronic
967941074 3:194767324-194767346 CCAAAGAGGTGGAACTGGGCTGG + Intergenic
968433577 4:573733-573755 CCCAAGACTTGGAGCCGGACTGG + Intergenic
969412029 4:7034625-7034647 CCCGAGACGTGGAGCCTGCCAGG + Intergenic
976568744 4:86584200-86584222 CCAAAGAGCTAGAGCTGGGCTGG - Intronic
979511469 4:121558840-121558862 TCCAAGAGGTGGAGCCGGTCAGG + Intergenic
988906767 5:35798465-35798487 CCAATGACGTGGAGGAGGGCAGG - Intronic
989998184 5:50860773-50860795 CCAAAGATGTGGTGGTGGGCTGG - Intergenic
992551801 5:77866426-77866448 CCAAAGGAGTGGAGCCAGGGTGG + Intronic
995864486 5:116676762-116676784 CCAGAGACGTGGGCCAGGGCAGG - Intergenic
997188605 5:131907581-131907603 CCCAAAACCTTGAGCCGGGCAGG + Intronic
997206318 5:132052319-132052341 CCAAGGAGGTGGAGGAGGGCAGG + Intergenic
998016413 5:138735635-138735657 CCACAGAGTTGGAGCTGGGCTGG + Intronic
1004683935 6:17923494-17923516 CCAAAGACCTGGAGGCTGCCAGG + Intronic
1006814566 6:36841039-36841061 CCAAAAACCTGGTGCTGGGCTGG + Intergenic
1017655264 6:156621766-156621788 GCACAGACCTGGAGCCGGACTGG + Intergenic
1017816450 6:158019670-158019692 CCAAAGCCTCGGAGCAGGGCTGG - Intronic
1018923928 6:168193868-168193890 GGAAGGACCTGGAGCCGGGCCGG + Intergenic
1019298022 7:289496-289518 CCAAATCCGTGGGGCCCGGCGGG - Intergenic
1019440448 7:1043591-1043613 CCAGGGACCTGGTGCCGGGCTGG + Intronic
1021874624 7:25036981-25037003 CCAAAGACTTGGAGAAGGGAAGG + Intergenic
1027901560 7:84121932-84121954 TCAAAGACTTGGAACCGGCCGGG - Intronic
1029420487 7:100469462-100469484 CCAACGTCGTGGAGCCAGCCTGG - Intronic
1029525130 7:101089349-101089371 CCACAGACACGGAGCCCGGCTGG - Exonic
1031586228 7:123534735-123534757 CCAAAGACTGGGGGCGGGGCCGG + Intronic
1035021926 7:155805310-155805332 GCAAAGGCGTGGAGCGGGGGCGG - Intronic
1036707971 8:11059377-11059399 CCAGCGAACTGGAGCCGGGCTGG + Intronic
1038143953 8:24876443-24876465 CCAAAGACGTGGCTCTAGGCAGG + Intergenic
1039374834 8:37022971-37022993 CCAAAGGGTTGGAGCAGGGCAGG + Intergenic
1042136037 8:65633951-65633973 ACAAAGCAGTGGAGCCGGGAAGG - Intronic
1049177784 8:141205161-141205183 ACAAAGATGTGAAGACGGGCCGG + Intergenic
1049461989 8:142734559-142734581 CCAAAGAGGAAGAGCTGGGCTGG + Intronic
1049769223 8:144372141-144372163 CCAGAGCCCTGCAGCCGGGCAGG + Intergenic
1054745031 9:68845372-68845394 CCAGAGCCGTGGAGCCGTGGGGG + Intronic
1056847036 9:90047700-90047722 CCTAAGATTTGGAGCCTGGCAGG - Intergenic
1060750706 9:126166535-126166557 CCAAGGACGTGGAGTCAGGAAGG + Intergenic
1062411202 9:136425570-136425592 CCAAAGAAGTGAAGTGGGGCTGG - Intergenic
1203469752 Un_GL000220v1:111345-111367 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1203477573 Un_GL000220v1:155317-155339 CCGAAGACGGGGAGCCGGCGCGG - Intergenic
1187507159 X:19887307-19887329 CCATTGGCGTCGAGCCGGGCCGG + Exonic
1189430193 X:40939450-40939472 CCAAAGACTTTGAGCAGGGCTGG + Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic