ID: 1148903361

View in Genome Browser
Species Human (GRCh38)
Location 17:50895262-50895284
Sequence CCTGAAGAGACACAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148903361_1148903371 28 Left 1148903361 17:50895262-50895284 CCCGCCTCCTGTGTCTCTTCAGG No data
Right 1148903371 17:50895313-50895335 CTTCGCTTGCCTCCTTACTGGGG No data
1148903361_1148903370 27 Left 1148903361 17:50895262-50895284 CCCGCCTCCTGTGTCTCTTCAGG No data
Right 1148903370 17:50895312-50895334 TCTTCGCTTGCCTCCTTACTGGG No data
1148903361_1148903372 29 Left 1148903361 17:50895262-50895284 CCCGCCTCCTGTGTCTCTTCAGG No data
Right 1148903372 17:50895314-50895336 TTCGCTTGCCTCCTTACTGGGGG No data
1148903361_1148903369 26 Left 1148903361 17:50895262-50895284 CCCGCCTCCTGTGTCTCTTCAGG No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148903361 Original CRISPR CCTGAAGAGACACAGGAGGC GGG (reversed) Intergenic