ID: 1148903364

View in Genome Browser
Species Human (GRCh38)
Location 17:50895266-50895288
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148903364_1148903371 24 Left 1148903364 17:50895266-50895288 CCTCCTGTGTCTCTTCAGGACGC No data
Right 1148903371 17:50895313-50895335 CTTCGCTTGCCTCCTTACTGGGG No data
1148903364_1148903369 22 Left 1148903364 17:50895266-50895288 CCTCCTGTGTCTCTTCAGGACGC No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data
1148903364_1148903372 25 Left 1148903364 17:50895266-50895288 CCTCCTGTGTCTCTTCAGGACGC No data
Right 1148903372 17:50895314-50895336 TTCGCTTGCCTCCTTACTGGGGG No data
1148903364_1148903370 23 Left 1148903364 17:50895266-50895288 CCTCCTGTGTCTCTTCAGGACGC No data
Right 1148903370 17:50895312-50895334 TCTTCGCTTGCCTCCTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148903364 Original CRISPR GCGTCCTGAAGAGACACAGG AGG (reversed) Intergenic