ID: 1148903367

View in Genome Browser
Species Human (GRCh38)
Location 17:50895301-50895323
Sequence GGCAAGCGAAGAAACTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148903367_1148903372 -10 Left 1148903367 17:50895301-50895323 CCTTTCCAGTTTCTTCGCTTGCC No data
Right 1148903372 17:50895314-50895336 TTCGCTTGCCTCCTTACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148903367 Original CRISPR GGCAAGCGAAGAAACTGGAA AGG (reversed) Intergenic