ID: 1148903369

View in Genome Browser
Species Human (GRCh38)
Location 17:50895311-50895333
Sequence TTCTTCGCTTGCCTCCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148903363_1148903369 25 Left 1148903363 17:50895263-50895285 CCGCCTCCTGTGTCTCTTCAGGA No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data
1148903364_1148903369 22 Left 1148903364 17:50895266-50895288 CCTCCTGTGTCTCTTCAGGACGC No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data
1148903360_1148903369 29 Left 1148903360 17:50895259-50895281 CCACCCGCCTCCTGTGTCTCTTC No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data
1148903365_1148903369 19 Left 1148903365 17:50895269-50895291 CCTGTGTCTCTTCAGGACGCGAG No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data
1148903361_1148903369 26 Left 1148903361 17:50895262-50895284 CCCGCCTCCTGTGTCTCTTCAGG No data
Right 1148903369 17:50895311-50895333 TTCTTCGCTTGCCTCCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148903369 Original CRISPR TTCTTCGCTTGCCTCCTTAC TGG Intergenic