ID: 1148903371

View in Genome Browser
Species Human (GRCh38)
Location 17:50895313-50895335
Sequence CTTCGCTTGCCTCCTTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148903361_1148903371 28 Left 1148903361 17:50895262-50895284 CCCGCCTCCTGTGTCTCTTCAGG No data
Right 1148903371 17:50895313-50895335 CTTCGCTTGCCTCCTTACTGGGG No data
1148903364_1148903371 24 Left 1148903364 17:50895266-50895288 CCTCCTGTGTCTCTTCAGGACGC No data
Right 1148903371 17:50895313-50895335 CTTCGCTTGCCTCCTTACTGGGG No data
1148903363_1148903371 27 Left 1148903363 17:50895263-50895285 CCGCCTCCTGTGTCTCTTCAGGA No data
Right 1148903371 17:50895313-50895335 CTTCGCTTGCCTCCTTACTGGGG No data
1148903365_1148903371 21 Left 1148903365 17:50895269-50895291 CCTGTGTCTCTTCAGGACGCGAG No data
Right 1148903371 17:50895313-50895335 CTTCGCTTGCCTCCTTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148903371 Original CRISPR CTTCGCTTGCCTCCTTACTG GGG Intergenic