ID: 1148906132

View in Genome Browser
Species Human (GRCh38)
Location 17:50913404-50913426
Sequence TGAGATTGCCTTGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148906132_1148906142 25 Left 1148906132 17:50913404-50913426 CCTGTTTTTCCAAGGCAATCTCA No data
Right 1148906142 17:50913452-50913474 CAGGAGAGTGGAGCTGCTCAAGG No data
1148906132_1148906141 13 Left 1148906132 17:50913404-50913426 CCTGTTTTTCCAAGGCAATCTCA No data
Right 1148906141 17:50913440-50913462 ATGTATAAATCACAGGAGAGTGG No data
1148906132_1148906135 6 Left 1148906132 17:50913404-50913426 CCTGTTTTTCCAAGGCAATCTCA No data
Right 1148906135 17:50913433-50913455 ACCCCCCATGTATAAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148906132 Original CRISPR TGAGATTGCCTTGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr