ID: 1148906720

View in Genome Browser
Species Human (GRCh38)
Location 17:50917074-50917096
Sequence CTATGGGGCTTGGAGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148906720_1148906725 -1 Left 1148906720 17:50917074-50917096 CCAGGGCACTCCAAGCCCCATAG No data
Right 1148906725 17:50917096-50917118 GAGTGACTCACTTTCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148906720 Original CRISPR CTATGGGGCTTGGAGTGCCC TGG (reversed) Intergenic
No off target data available for this crispr