ID: 1148906999

View in Genome Browser
Species Human (GRCh38)
Location 17:50918325-50918347
Sequence CTGTCCTCAAAGCTGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148906999_1148907002 5 Left 1148906999 17:50918325-50918347 CCTGACTGCAGCTTTGAGGACAG No data
Right 1148907002 17:50918353-50918375 GCCCTCCCCTCCCAGGCAGCGGG No data
1148906999_1148907001 4 Left 1148906999 17:50918325-50918347 CCTGACTGCAGCTTTGAGGACAG No data
Right 1148907001 17:50918352-50918374 TGCCCTCCCCTCCCAGGCAGCGG No data
1148906999_1148907011 26 Left 1148906999 17:50918325-50918347 CCTGACTGCAGCTTTGAGGACAG No data
Right 1148907011 17:50918374-50918396 GGCCCCTTCCCTGGCCCCAGAGG No data
1148906999_1148907000 -2 Left 1148906999 17:50918325-50918347 CCTGACTGCAGCTTTGAGGACAG No data
Right 1148907000 17:50918346-50918368 AGCACTTGCCCTCCCCTCCCAGG No data
1148906999_1148907010 17 Left 1148906999 17:50918325-50918347 CCTGACTGCAGCTTTGAGGACAG No data
Right 1148907010 17:50918365-50918387 CAGGCAGCGGGCCCCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148906999 Original CRISPR CTGTCCTCAAAGCTGCAGTC AGG (reversed) Intergenic
No off target data available for this crispr