ID: 1148907562

View in Genome Browser
Species Human (GRCh38)
Location 17:50920972-50920994
Sequence TCTTAGATCCGGGAGCTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148907562_1148907570 12 Left 1148907562 17:50920972-50920994 CCCACGAGCTCCCGGATCTAAGA No data
Right 1148907570 17:50921007-50921029 AAGCGAGAATCTCCAAGCCCAGG No data
1148907562_1148907572 28 Left 1148907562 17:50920972-50920994 CCCACGAGCTCCCGGATCTAAGA No data
Right 1148907572 17:50921023-50921045 GCCCAGGCCCCTCCCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148907562 Original CRISPR TCTTAGATCCGGGAGCTCGT GGG (reversed) Intergenic