ID: 1148909733

View in Genome Browser
Species Human (GRCh38)
Location 17:50935021-50935043
Sequence TATGTCTAGCAGAGTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148909730_1148909733 6 Left 1148909730 17:50934992-50935014 CCTTTGAGTATTTTTATCTTTAG 0: 1
1: 0
2: 5
3: 45
4: 612
Right 1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148909733 Original CRISPR TATGTCTAGCAGAGTCTGGG TGG Intergenic
901573358 1:10179966-10179988 TGTGTCTAGCAGAGGGTGGGCGG - Exonic
901807651 1:11748403-11748425 TGTGTCTTGCAGTTTCTGGGTGG + Exonic
902156403 1:14490666-14490688 TATTTTTAGCAGAGACGGGGTGG + Intergenic
903315388 1:22500334-22500356 TGTGTCCAGCAGAATCTGTGTGG + Intronic
908829944 1:68168768-68168790 TATGTCTGCCAGAGGCTGGGAGG - Intronic
911313925 1:96332869-96332891 TATGATTAGCAGAGGCTGGGAGG - Intergenic
912877928 1:113381131-113381153 GATGTTTACCAAAGTCTGGGGGG - Intergenic
913548968 1:119897752-119897774 TAAGTCCAGCAGAGTCTAAGTGG - Intergenic
915037559 1:152941594-152941616 TGTGTCCTGGAGAGTCTGGGAGG + Intergenic
916571623 1:166033085-166033107 TAGGGCTGGCAGAGTCCGGGTGG - Intergenic
917054872 1:170970057-170970079 TGTCTCTAGCAGAGTATGTGTGG - Intronic
919631925 1:199967740-199967762 TATGTTTTGCACAGTCTGGTTGG - Intergenic
919741075 1:200982070-200982092 TGGGCCTGGCAGAGTCTGGGGGG - Intronic
919813116 1:201421335-201421357 GATGCCCAGCAGAGTGTGGGAGG - Intronic
920953686 1:210598105-210598127 TGTGTCTAGAAATGTCTGGGAGG + Intronic
921983815 1:221286611-221286633 TGTGGCAAGCAGAGTCTGGTGGG + Intergenic
922421027 1:225461344-225461366 GATGTTTACCAGAGTCTGGAGGG + Intergenic
1068777228 10:60881064-60881086 TATCACTAGAATAGTCTGGGGGG - Intronic
1068936718 10:62643003-62643025 TATGTATAGTTGAGCCTGGGTGG + Intronic
1069745435 10:70712123-70712145 TGTGATTTGCAGAGTCTGGGTGG - Intronic
1071211682 10:83348743-83348765 TGTGTCTAGAAATGTCTGGGAGG - Intergenic
1073467598 10:103703260-103703282 GGTGTCTAGGAAAGTCTGGGAGG - Intronic
1074751580 10:116592049-116592071 TAGGTCTAGCTAGGTCTGGGGGG - Intronic
1075002320 10:118807976-118807998 ATTGTCTAGCAGAGGCTGGTGGG - Intergenic
1077296690 11:1829691-1829713 CATGTCTTGAAGTGTCTGGGTGG - Intronic
1080751127 11:35151362-35151384 TCTGTCTAGCACTGTCTGAGAGG - Intronic
1085125901 11:74002175-74002197 TGTGACTAGCTGAGTCTGGTGGG - Intronic
1086477514 11:87193236-87193258 TGTGTCTAGCAGATTCTAAGTGG + Intronic
1086606325 11:88700778-88700800 TATGTGTAGCAGTTTCTGGTAGG - Intronic
1087587602 11:100141864-100141886 TATGTCTAGGTGTGTCTGTGAGG + Intronic
1089494769 11:118902492-118902514 AATGTCTCGCAGCGTCTGGAGGG + Exonic
1090498521 11:127238601-127238623 TATGTTTGGCAAAGTCTGAGTGG - Intergenic
1094017190 12:25877914-25877936 TATGACTTACAGAGTTTGGGGGG + Intergenic
1094089251 12:26629773-26629795 AAAGTCTAGCAAAGGCTGGGTGG - Intronic
1094419747 12:30258006-30258028 TTTGTCTAGAAATGTCTGGGAGG - Intergenic
1095693176 12:45113958-45113980 TATTTTTAGTAGAGACTGGGGGG - Intergenic
1096277318 12:50220599-50220621 TGTTCCTAGCAGGGTCTGGGAGG + Intronic
1100338655 12:93656906-93656928 TATGTCTGGGTGTGTCTGGGAGG - Intergenic
1100462319 12:94812465-94812487 TTGGTCTAGCAGTGTCTGAGGGG + Intergenic
1101125944 12:101633767-101633789 GATGTCAAGCAGAGGCTGGATGG + Intronic
1103033117 12:117633956-117633978 TATGTGAAGCAGAGTCAGGCAGG - Intronic
1103656084 12:122471672-122471694 TATTTCTAGCACATTCTGTGAGG + Intergenic
1103968151 12:124653096-124653118 TGTGGGTGGCAGAGTCTGGGAGG - Intergenic
1107025231 13:35794925-35794947 TAGGAATAGCAGAGTGTGGGAGG + Intronic
1107250984 13:38362574-38362596 TATTTTTAGCAGAGACAGGGAGG + Intronic
1107503439 13:41005425-41005447 TAGGTATAGCAGAGGTTGGGGGG - Intronic
1111575689 13:90151600-90151622 AATCAGTAGCAGAGTCTGGGAGG - Intergenic
1113400028 13:109982985-109983007 TACGTCTAGCAGAATCTGAGGGG + Intergenic
1113403835 13:110019960-110019982 GATGGCTACCAGAGGCTGGGAGG - Intergenic
1114743135 14:25118661-25118683 TTTCTCTATCAGAATCTGGGAGG - Intergenic
1115073557 14:29357796-29357818 AATGTGTTGAAGAGTCTGGGAGG - Intergenic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1117593045 14:57295797-57295819 TATGTATTGCAGCTTCTGGGAGG - Exonic
1119078275 14:71666794-71666816 AATGTCTAGCATAGGCAGGGAGG + Intronic
1120059132 14:79961075-79961097 TATGTTTAGCAGATGCTGTGTGG - Intergenic
1120299369 14:82686634-82686656 GATGGTTACCAGAGTCTGGGAGG - Intergenic
1122209040 14:100163101-100163123 TATCTCTAGCTCAGTCTTGGGGG - Intergenic
1122236633 14:100334116-100334138 TCTGTCCTGCAGAGTCAGGGTGG - Exonic
1130907186 15:88249124-88249146 TAAGTGTCCCAGAGTCTGGGTGG - Intronic
1130965637 15:88695643-88695665 TATGTCTAGCAGAATTTGGGGGG - Intergenic
1141924523 16:87159199-87159221 GATGGCTACCAGAGGCTGGGAGG + Intronic
1147204310 17:38825619-38825641 TAGGTCTAGCAGAGACTACGTGG - Intergenic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1153746262 18:8183035-8183057 TAACTGTAGCTGAGTCTGGGGGG - Intronic
1154346582 18:13548159-13548181 TGAGTCTGGCTGAGTCTGGGGGG + Intronic
1156657349 18:39304771-39304793 TATTTCTAGCTGTGTCTGTGAGG + Intergenic
1157880721 18:51318762-51318784 TATTTTTAGTAGAGACTGGGGGG + Intergenic
1158099806 18:53818419-53818441 TATGTCTAGGAGTGCCTGTGAGG - Intergenic
1162017144 19:7851949-7851971 TGTGTCTGGCAGAGCCTAGGGGG - Intronic
1164139484 19:22445616-22445638 TCTGTCTAATAGAGTCTGTGGGG + Intronic
1166400024 19:42471728-42471750 TGTGTCTAACAGAGTCGGAGTGG - Intergenic
924991628 2:317528-317550 TTTGTCGAGCTGAGTCAGGGAGG + Intergenic
925992447 2:9264325-9264347 CATGTCTTCCAGAGACTGGGGGG + Intronic
927078661 2:19605717-19605739 TATGTCTATTAGAGTATTGGAGG + Intergenic
927373037 2:22379766-22379788 AATGTCTAGGAGAGACTGGAGGG - Intergenic
927961360 2:27242363-27242385 GATGTCCAGCAGGGCCTGGGTGG - Exonic
928557576 2:32444117-32444139 GATGGATACCAGAGTCTGGGAGG + Intronic
932012969 2:67996866-67996888 TAGTTGTAGCAGAGTCTGTGTGG - Intergenic
932709033 2:74048343-74048365 TGTGTCCAGCAGACTCTTGGTGG - Exonic
937670421 2:124532351-124532373 AATGTCTAGCAGGGTCTGAGTGG + Intronic
945407454 2:209467084-209467106 TCTGTCAATTAGAGTCTGGGTGG - Intronic
946814448 2:223562492-223562514 TATATCTAGCAGTGTGTGTGTGG + Intergenic
948011185 2:234650306-234650328 GATGTATAGCAGAGTCAGGTTGG + Intergenic
948344689 2:237285869-237285891 TATTTCTAGGAGTGTCTGTGAGG + Intergenic
948395669 2:237643260-237643282 CATTTCTAGCAAATTCTGGGTGG - Intronic
948574426 2:238940643-238940665 TGTGTCTGGCGGAGACTGGGAGG - Intergenic
1173914090 20:46693648-46693670 TATGTGTAGTAGAGTGGGGGTGG + Intergenic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1175325282 20:58121903-58121925 GATGGCTACCAGAGTCTGGGAGG + Intergenic
1176083810 20:63286824-63286846 TCTGTCTCCCAGACTCTGGGTGG + Intronic
1177029560 21:15966018-15966040 TATGTCTAGCTGGGTCTTAGAGG + Intergenic
1177693494 21:24540819-24540841 TATATCTAGTAGAGTCTTGGTGG - Intergenic
1178131627 21:29579729-29579751 AATGACAAGCAGAGTCTGGTTGG + Intronic
1181484188 22:23220116-23220138 CATGTCTAGCAGAGCATGCGGGG + Intronic
1183044699 22:35210590-35210612 TTTGTCAAGAAGAGCCTGGGGGG + Intergenic
1183604013 22:38858239-38858261 TTTGTCCAGCAGTGCCTGGGTGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949098822 3:118869-118891 TGTGTCTATTAGAGTCTGAGAGG + Intergenic
950839410 3:15952442-15952464 TATGTCTGGGTGTGTCTGGGAGG + Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951965323 3:28376532-28376554 TATGTCTGGCAGATTGTGGGAGG + Intronic
953222921 3:40989693-40989715 TATGGATAACAGAGTGTGGGAGG - Intergenic
954770890 3:52967398-52967420 TATGGATGTCAGAGTCTGGGTGG + Intronic
958185282 3:90111806-90111828 TATGTCTAGGTGTGTCTGTGAGG + Intergenic
965751693 3:171981433-171981455 AATGCCTAGCTGTGTCTGGGAGG + Intergenic
971046395 4:22809925-22809947 TATTTCCCTCAGAGTCTGGGAGG - Intergenic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
976581691 4:86744235-86744257 TCAGTCAAGTAGAGTCTGGGTGG - Intronic
981014283 4:139957361-139957383 TTAGTCTAGCAGAGCCTGGTTGG - Intronic
983377261 4:166945893-166945915 TAAGTGGAGCAGAGTATGGGAGG - Intronic
983519994 4:168698181-168698203 GATGGCTACCAGAGGCTGGGAGG + Intronic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
986282938 5:6338175-6338197 TATGGGTTGCAGAATCTGGGTGG + Intergenic
986861435 5:11931553-11931575 TACGTCTAGCAGCCTCGGGGGGG - Intergenic
988410657 5:30881512-30881534 TATTTCTGGGTGAGTCTGGGAGG - Intergenic
994164243 5:96592221-96592243 TATTTCTAGCAGAGACAGGGTGG - Intronic
995152820 5:108869782-108869804 TCAGTCAAGCAGAGTCTGGAAGG - Intronic
997698436 5:135879742-135879764 CATGTGTATCAGGGTCTGGGAGG + Intronic
999806397 5:155085441-155085463 CATTTCTAGCAGCTTCTGGGTGG - Intergenic
1001119283 5:168966302-168966324 TTTGCCTAGAAGAGTCTGAGAGG + Intronic
1001445209 5:171777538-171777560 TGTGGCAAGCAGAGGCTGGGAGG - Intergenic
1006191518 6:32212613-32212635 TAAGTCCATCAGAGTCTGAGGGG + Exonic
1006784689 6:36658203-36658225 TGTGACTTGCAGTGTCTGGGAGG + Intergenic
1007076241 6:39068404-39068426 AATGACTAGCAGAGTCATGGGGG - Intronic
1012486288 6:99725493-99725515 TGTGTCTAGAAATGTCTGGGAGG + Intergenic
1012547435 6:100435591-100435613 TCTGTCTGGGAGAGACTGGGAGG - Intronic
1013851407 6:114520368-114520390 TATTTCTAGGTGAGTCTGTGAGG - Intergenic
1020228989 7:6302706-6302728 TATGTCTTGCAGATTCATGGCGG - Intergenic
1023838240 7:44080799-44080821 TATGTCCAGCAGAGCTGGGGGGG + Exonic
1024184802 7:46939252-46939274 TATTTCTAGCAGAATCTGAGAGG - Intergenic
1031291677 7:119945510-119945532 TATGTTGTGCAGAGTCTGGAAGG + Intergenic
1041976696 8:63807278-63807300 GATGGTTAGCAGAGGCTGGGGGG + Intergenic
1043454577 8:80400776-80400798 TATGTCTTGCAAAGTCTAAGAGG - Intergenic
1048182492 8:132208929-132208951 TATTTGTATCAGGGTCTGGGAGG + Intronic
1048318891 8:133383234-133383256 TCTGGCCAGCAGAGCCTGGGAGG + Intergenic
1048757162 8:137752588-137752610 TATTTCTAGCTGTGTCTGTGAGG + Intergenic
1052210852 9:25901599-25901621 TATGTCTACCAGAGTTTGCCAGG - Intergenic
1052533250 9:29715393-29715415 GAGGTCTAGCAGACGCTGGGAGG - Intergenic
1058402543 9:104634924-104634946 TCTGTCTGGCTGAGTCTGGCTGG + Intergenic
1058526623 9:105865567-105865589 TTTCTCTAGCAGAGCCTGGCTGG + Intergenic
1059671820 9:116499262-116499284 AGTGTCTAGCAGAGTGTGGGGGG + Intronic
1185477580 X:424660-424682 TATTTTTAGCAGAGGCGGGGGGG - Intergenic
1187759609 X:22566142-22566164 TCTGTCTCGCTGAGGCTGGGTGG - Intergenic
1197773971 X:130108464-130108486 TGTGTCTAGCTGGGTCTGTGCGG + Intronic
1201057913 Y:10014279-10014301 TGTGTTTAGAAGAGTCTTGGTGG - Intergenic
1201921463 Y:19238321-19238343 TAGGGATAGCAGAATCTGGGAGG - Intergenic
1201945135 Y:19502970-19502992 TCTGTCTCGCAGTGCCTGGGCGG - Intergenic