ID: 1148909772

View in Genome Browser
Species Human (GRCh38)
Location 17:50935198-50935220
Sequence CTGTTTTCACAGTGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 290}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148909772_1148909777 10 Left 1148909772 17:50935198-50935220 CCTGCTTCCCACTGTGAAAACAG 0: 1
1: 0
2: 2
3: 27
4: 290
Right 1148909777 17:50935231-50935253 AGATTCCTCAGCCCCTAGCTGGG 0: 1
1: 0
2: 0
3: 28
4: 165
1148909772_1148909779 17 Left 1148909772 17:50935198-50935220 CCTGCTTCCCACTGTGAAAACAG 0: 1
1: 0
2: 2
3: 27
4: 290
Right 1148909779 17:50935238-50935260 TCAGCCCCTAGCTGGGTGCCTGG 0: 1
1: 0
2: 2
3: 49
4: 404
1148909772_1148909783 24 Left 1148909772 17:50935198-50935220 CCTGCTTCCCACTGTGAAAACAG 0: 1
1: 0
2: 2
3: 27
4: 290
Right 1148909783 17:50935245-50935267 CTAGCTGGGTGCCTGGAGAGAGG 0: 1
1: 0
2: 1
3: 23
4: 257
1148909772_1148909776 9 Left 1148909772 17:50935198-50935220 CCTGCTTCCCACTGTGAAAACAG 0: 1
1: 0
2: 2
3: 27
4: 290
Right 1148909776 17:50935230-50935252 CAGATTCCTCAGCCCCTAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148909772 Original CRISPR CTGTTTTCACAGTGGGAAGC AGG (reversed) Intergenic
900957637 1:5897021-5897043 CAGTTTTCAGAGTGAGAAGTCGG - Intronic
900960317 1:5914969-5914991 CTGTTTGCTCAGTGGCAGGCTGG - Intronic
901007097 1:6177337-6177359 CTGTCTTCACAGCCAGAAGCTGG + Intronic
901055894 1:6448478-6448500 TGGTTCTCACAGTGGGCAGCGGG - Intronic
902478502 1:16700160-16700182 CTGTTCTCACGGTGGGCAGCGGG + Intergenic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903041031 1:20530799-20530821 CTGCTTTCACAGTGGGAGTTGGG + Intergenic
903564105 1:24251657-24251679 ATGTTATCATTGTGGGAAGCTGG - Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
905273036 1:36799458-36799480 ATGTGTGCACAGTGGGGAGCGGG - Exonic
905518605 1:38580366-38580388 CTGTGTTCCCAGTGGGACGTGGG - Intergenic
906451623 1:45954219-45954241 GTTGCTTCACAGTGGGAAGCAGG + Intronic
906766159 1:48436337-48436359 CAGTTTTCACTGTTGGCAGCTGG + Intronic
907854748 1:58291717-58291739 CAGTTTTCATTGTGGGAACCTGG + Intronic
909087135 1:71181420-71181442 ACATTCTCACAGTGGGAAGCTGG + Intergenic
910698369 1:90046138-90046160 CAGTTTTTATAGTGGGAAGCAGG + Intergenic
910861534 1:91747172-91747194 CTCTTTCCACTGTGGGAAGGTGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
916179861 1:162073832-162073854 CTGTGTTCAGAGTGGGTACCTGG + Intronic
916425234 1:164673967-164673989 CTGCTTACACATTGGGAAACTGG + Intronic
916487947 1:165275989-165276011 GAGTTTTCACAAAGGGAAGCTGG + Intronic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
917809105 1:178640731-178640753 TTATTTTCACTGGGGGAAGCTGG + Intergenic
918186865 1:182135353-182135375 CTGTTTCCAAATTGGGAAGTAGG - Intergenic
920530842 1:206701162-206701184 CTGTATTCTCAGTGGGATCCAGG - Intronic
920728719 1:208462486-208462508 CTTGTTTTACAGTGGGAATCAGG - Intergenic
921159335 1:212462323-212462345 CTGTTTGCCCAGTGGTGAGCTGG + Intergenic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
922093559 1:222421305-222421327 CCCTTTTCACAGTGAGAAGAAGG + Intergenic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
923055658 1:230424919-230424941 CTGTGGCCACAGTGGTAAGCAGG + Intronic
923148864 1:231216679-231216701 CCAGTCTCACAGTGGGAAGCTGG - Exonic
923205684 1:231756954-231756976 CTGTTTTCACAGTGACCACCAGG + Intronic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
923519819 1:234726678-234726700 CTGTTTTCTCAGGGGGAAGCGGG + Intergenic
924010402 1:239659063-239659085 CTGTTTTCACAATGTGAACATGG - Intronic
1062957182 10:1548029-1548051 CTGTTTTCCCTCTGGGAGGCTGG + Intronic
1063334430 10:5198327-5198349 CTGTTTTCAAAGTTGGAGCCTGG + Intronic
1063376675 10:5558322-5558344 CTGCCTTCACCCTGGGAAGCTGG - Intergenic
1063390903 10:5649342-5649364 CTGTTCTCACAGCAAGAAGCCGG - Intronic
1063753333 10:8977049-8977071 CAGCTTCCACACTGGGAAGCAGG - Intergenic
1065179601 10:23111457-23111479 CTGTATTCACAGTGCAAAGAGGG - Intronic
1067352080 10:45485501-45485523 CTCTCTTCAAAGTGGGCAGCTGG - Intronic
1068050040 10:51938634-51938656 GTGTCTTCTCAGTGGGAAGAGGG - Intronic
1068285167 10:54924132-54924154 CTGTTCTCACATGGTGAAGCAGG + Intronic
1070465772 10:76722174-76722196 ATGTTTTCAAAGTGGGCAGATGG - Intergenic
1071146643 10:82582356-82582378 CTGTTTTCACAAAGGGCAGGGGG + Intronic
1072210667 10:93243949-93243971 CTGTCTTCAAGGTGGGAAACTGG - Intergenic
1073782677 10:106856641-106856663 CAGTTGTCACTGTGGGGAGCTGG + Intronic
1074066732 10:110021982-110022004 CTGTTTTCCCAGTAGAAAGTTGG + Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1079029371 11:16974513-16974535 ATGTTATCACTGAGGGAAGCTGG - Intronic
1080614694 11:33935766-33935788 CTGTTGTCACATTGGACAGCAGG - Intergenic
1080684327 11:34502778-34502800 CTGTTTTCTCAGTGGGTGGTGGG + Intronic
1082774522 11:57235272-57235294 CTGTTTTCTGAGTGTGAGGCAGG - Exonic
1082941446 11:58709571-58709593 CAGGTTTCTCAGTGGGAAGCAGG - Exonic
1085240527 11:75050398-75050420 CTGGGTTCACACTGGTAAGCTGG + Intergenic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1087625661 11:100593145-100593167 CTGTTTTCACTTTGGGTGGCAGG + Intergenic
1088819664 11:113446591-113446613 CTGTTTCCACAGTGGCAATGAGG + Intronic
1090271778 11:125391102-125391124 CTTTTTGCAAATTGGGAAGCTGG - Intronic
1090349708 11:126100021-126100043 CTGTTTTCTCATTAGGAAACTGG + Intergenic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1091692671 12:2607591-2607613 CTGTATTTACAGTGGAAAGTAGG + Intronic
1091723932 12:2832979-2833001 CTGTGTTCATCGTGGGAAGGTGG - Intronic
1092980362 12:13788601-13788623 TTGTTTTCCCAGTGGGCACCAGG - Intronic
1093238750 12:16642498-16642520 CTGTTTTATAAGGGGGAAGCTGG - Intergenic
1093473752 12:19532735-19532757 CTGTCTTCACTGTGAGAACCTGG + Intronic
1098590240 12:72202479-72202501 CTATTTCTACTGTGGGAAGCTGG + Intronic
1101223668 12:102666410-102666432 TTGTTTTAACTGTGGGAAGCAGG - Intergenic
1101752656 12:107595399-107595421 GTGTATTCAGAGTGGGAAGCAGG + Intronic
1102961653 12:117097337-117097359 CTGTCATCCCAGTGGGAGGCTGG + Intronic
1103716887 12:122950185-122950207 CTGTTTTCCAAGTAGGAATCTGG - Intronic
1104054710 12:125220606-125220628 GTTTTCTCACAGTGGGAGGCAGG + Intronic
1104493260 12:129213094-129213116 CAGTTATCACAGTGGGCACCTGG + Intronic
1104680032 12:130743766-130743788 CTGAATTCAGAATGGGAAGCAGG - Intergenic
1104711957 12:130993642-130993664 CCCATGTCACAGTGGGAAGCAGG - Intronic
1104718536 12:131031894-131031916 CTGCCTTCCCTGTGGGAAGCTGG + Intronic
1105622384 13:22080891-22080913 CTGTTTTCAAATAGGGTAGCTGG + Intergenic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1107098298 13:36560315-36560337 CTGTCTGCACAGTGTGAAGGAGG - Intergenic
1107896684 13:44971710-44971732 CTGTTTTCCCAGTGAAAAGGGGG + Intronic
1108091268 13:46852438-46852460 CTGTTACCGCAGTGGGAAGAGGG - Intronic
1111817027 13:93167021-93167043 CAGTTTTCATAGTGAGCAGCTGG - Intergenic
1112299588 13:98217959-98217981 GTGTTTTCACAGCGTGAAGGTGG + Intronic
1112669064 13:101613924-101613946 CTGTTTGCTCAGTGGGAAGTAGG - Intronic
1113228266 13:108182254-108182276 CTGTATTGAAAGTGGGAAACAGG - Intergenic
1113707848 13:112445762-112445784 AAGATTTCACAGTGAGAAGCTGG + Intergenic
1114260527 14:21033251-21033273 ATGATTTCACAGAGAGAAGCAGG + Exonic
1114308422 14:21443930-21443952 CTGGTTTGACAGTGGAAAGTAGG - Intronic
1114644336 14:24245954-24245976 CAGTTTTCACTGTGGGATCCTGG + Intergenic
1115232475 14:31176277-31176299 CTGTTTTTACAGTAGACAGCTGG - Intronic
1116922872 14:50599231-50599253 CTGTTTTCTGATTGGGAACCAGG - Intronic
1117729117 14:58703786-58703808 CTGAATTCTGAGTGGGAAGCTGG + Intergenic
1117869665 14:60186949-60186971 CTGTTTCCCCAGTGGGAATGCGG - Intergenic
1119153542 14:72387699-72387721 AAGTCTTCACAGTGGGAAGTAGG + Intronic
1120671629 14:87368798-87368820 CTTTTTTCACATTGGGAAAAGGG + Intergenic
1120715509 14:87837014-87837036 CTGCTTTCACAGTGGGAATAAGG - Intergenic
1121980043 14:98446753-98446775 CTATTATAACAGTGGGAAGCAGG + Intergenic
1121987140 14:98518044-98518066 ATGTTTCCTCAGTGAGAAGCAGG - Intergenic
1126124418 15:45282626-45282648 CTGTTTCCCCAGTGGTAAACAGG + Intergenic
1127299063 15:57634788-57634810 CTGTTTTCCCAGGGGGTAGAAGG - Intronic
1128155396 15:65388737-65388759 CTGTTCTCACTGCTGGAAGCGGG + Intronic
1129705993 15:77794933-77794955 CTGTCCTCACACTGGGAAGCTGG - Intronic
1130829370 15:87583956-87583978 CCGTATTCACAGGGGTAAGCAGG - Intergenic
1130882818 15:88069808-88069830 CTGAACTCACAGAGGGAAGCTGG + Intronic
1134134553 16:11670123-11670145 CTGTTTTCCCAGTCAGAACCTGG + Intronic
1134821740 16:17252546-17252568 CTGTTTTCACGAGGGGAAGAGGG - Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1134849992 16:17471237-17471259 CTGTTTTCCCTGTGGGCCGCTGG + Intergenic
1136867190 16:33767865-33767887 CTGATTGCACGGTGGGAAGATGG - Intergenic
1137308879 16:47233484-47233506 CAGTCTTCACAGTGAGAATCTGG - Intronic
1137372111 16:47917067-47917089 CTGTTTTCCCAGTGAGAAAATGG + Intergenic
1141798569 16:86291610-86291632 CTGGGTTCACAGTGGGTGGCAGG - Intergenic
1142362178 16:89632707-89632729 CTGGTTTCTCAGTGGGAGGGAGG - Intronic
1203104972 16_KI270728v1_random:1348338-1348360 CTGATTGCACGGTGGGAAGATGG + Intergenic
1203128542 16_KI270728v1_random:1614030-1614052 CTGATTGCACGGTGGGAAGATGG - Intergenic
1203143844 16_KI270728v1_random:1786597-1786619 CTGTTTTCACAGCGTGGACCTGG + Intergenic
1143083530 17:4398781-4398803 CTGTTTGCAAAATGGAAAGCTGG + Intergenic
1143574800 17:7785968-7785990 CTGTTCACTCATTGGGAAGCTGG - Intronic
1143578373 17:7808612-7808634 CTGCTTTCAGAGAGGAAAGCTGG - Intronic
1145777295 17:27538379-27538401 CTGTTTTCAAAATGGGCAGGAGG + Intronic
1145809641 17:27756710-27756732 CTCTTCTCAGAGTGGGGAGCTGG - Intergenic
1146567071 17:33922699-33922721 CAGTTTTCACAGTGGAAAATGGG - Intronic
1146790356 17:35747358-35747380 CTGTTTTTAATGTGGGATGCGGG - Intronic
1147760970 17:42797150-42797172 TTCTTTTCACAATGGGAGGCAGG + Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1148972790 17:51498967-51498989 CTGTTCTCAGAGTGGAAAGATGG - Intergenic
1149030613 17:52078699-52078721 TTGTGTTCTAAGTGGGAAGCAGG + Intronic
1151507851 17:74541248-74541270 CCGTTTTCACAGGGAGAAGCAGG - Exonic
1153275925 18:3367802-3367824 ATGTTATCAATGTGGGAAGCAGG + Intergenic
1153671931 18:7419787-7419809 GTGTTTTCACAGTGGGCATGTGG - Intergenic
1155399376 18:25420982-25421004 CTGTCTTAATAGTGGGAATCTGG - Intergenic
1155601896 18:27558783-27558805 TAGTTTTCAGAGTGGGGAGCAGG - Intergenic
1156463103 18:37332659-37332681 CTGGTTTCCCAGGGGGAAGGAGG + Intronic
1157187326 18:45551775-45551797 CTGGCTTCACAGTGGAAAGCTGG + Intronic
1157339312 18:46765220-46765242 CTGTTTTCACACTTGTAAGTTGG - Intergenic
1157487498 18:48098880-48098902 CTGTTTACAAAGTGGCAAGATGG - Intronic
1158092435 18:53729570-53729592 CTGTTTTCAGATTTGGAAGTAGG + Intergenic
1159032257 18:63243558-63243580 CAGACTTCACAGTGGGATGCTGG - Intronic
1159696600 18:71565520-71565542 ATGTTTTCACATTGTGGAGCAGG + Intergenic
1159845461 18:73454219-73454241 CTGTATTCAGAGTGGAAATCCGG + Intergenic
1159888054 18:73928118-73928140 CTGGGCTCTCAGTGGGAAGCAGG + Intergenic
1160532747 18:79575137-79575159 CGGTTTCCACTGTGGGCAGCTGG + Intergenic
1161152399 19:2716616-2716638 CTGTCTTCACAGTGGGGTGTGGG - Exonic
1162042542 19:7979416-7979438 CTGTTTACACACTGGGCACCCGG + Intronic
1164500860 19:28819120-28819142 CTTTTTGCACAGTGGCTAGCAGG - Intergenic
1164656297 19:29924535-29924557 CTGTTCTCACAGTGGGAGGGAGG - Intronic
1166233710 19:41441178-41441200 TTCTATTCACAGTGGGAAGAAGG + Intergenic
1202712521 1_KI270714v1_random:25991-26013 CTGTTCTCACGGTGGGCAGCGGG + Intergenic
925043962 2:756801-756823 GTGTTCTCACAGTGGGGAGGTGG - Intergenic
927047823 2:19297761-19297783 CTGGCTTAACAGTGGGATGCTGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
929037853 2:37711770-37711792 TCTTTTTCACAGTGGGAAACTGG - Intronic
929203292 2:39261034-39261056 CTCTTTTCAGAGTTGGAACCTGG + Intronic
929660480 2:43779476-43779498 CTGTTTCCACAGTGTCTAGCAGG - Intronic
929713888 2:44291811-44291833 TTATCTGCACAGTGGGAAGCTGG + Intronic
929904251 2:46032392-46032414 CGGTTTTCCCAGGCGGAAGCTGG - Intronic
929929535 2:46241795-46241817 CTGTGTTCATAATTGGAAGCTGG - Intergenic
932461290 2:71883536-71883558 CTGTTTTCACCTTTGGAAACTGG - Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
935218920 2:100995414-100995436 CTCTTTGCACAGTGAGCAGCAGG + Exonic
935443952 2:103137040-103137062 CTTTCTTCACTGTGAGAAGCTGG + Intergenic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
938748697 2:134307527-134307549 CTGTTATCACAGCAGGAAACCGG - Intronic
939017540 2:136919923-136919945 CTGCTTTCACTGTGGGCAGCAGG + Intronic
939620298 2:144410684-144410706 CTGTGTTCACAGTGGAAGACAGG + Intronic
940416009 2:153420922-153420944 CAGGTACCACAGTGGGAAGCTGG + Intergenic
940846234 2:158644959-158644981 CTGATTTCACAGTGGAAACCTGG - Intronic
941301013 2:163801337-163801359 TTGTTTTAACTGTGGAAAGCAGG - Intergenic
944070793 2:195666323-195666345 CAGTTTTTACAATGGCAAGCTGG + Intronic
944617307 2:201474702-201474724 CAGTTTTCACTGTTGGCAGCTGG + Exonic
945106108 2:206316379-206316401 GTGCTTTCACAGTGGGTTGCTGG + Intergenic
946156718 2:217811822-217811844 CTGTTTTGATTGTGGGAAGTTGG - Intronic
946223471 2:218248875-218248897 CTGTTTTCACAGTGAGAATATGG + Intronic
947186775 2:227462706-227462728 CTGTTTTCACTCTGGGAACTTGG + Intergenic
947538896 2:230960945-230960967 CTGTCTTCACAGTGAGAAACTGG - Intronic
947856663 2:233328767-233328789 CTGTTTTCACAGCCTGGAGCTGG + Intronic
948487658 2:238291099-238291121 CTGTTGGCACTGTGGGAGGCAGG + Intergenic
948496951 2:238356715-238356737 CTGTTTGCAGACTGGGAGGCTGG + Intronic
1168758103 20:329764-329786 CTGTTTTCCCAGTAGGAGCCAGG + Exonic
1170824287 20:19780409-19780431 CTCTTATCTCAGTGGGTAGCAGG - Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1173677321 20:44847505-44847527 CTATTTTCACAAAAGGAAGCTGG + Intergenic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1175755146 20:61524966-61524988 CTATGTTCACAGTGGAAAGAAGG - Intronic
1176203690 20:63876753-63876775 CTGGTGTCACGGTGGGAGGCTGG + Intronic
1178853906 21:36235293-36235315 TTGTTTGCACTGTGGGAAGCAGG - Intronic
1179389604 21:40975698-40975720 CTGTGTTCTCACTGGAAAGCTGG + Intergenic
1181457004 22:23065400-23065422 CTGATACCACAGTGAGAAGCTGG - Intronic
1182340897 22:29620005-29620027 CTGTAATCCCAGTGGGAGGCCGG + Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183227904 22:36563009-36563031 TTGTTTTCACAGTTTAAAGCTGG + Intergenic
1183965172 22:41437156-41437178 CTGTGTTCACATTGGGGAGATGG - Exonic
1184033227 22:41906785-41906807 CTCTTTTCAGAGTGGGCAGAGGG + Exonic
1184404983 22:44295319-44295341 CTTTTTTCAAAATGGGTAGCTGG - Intronic
1184415217 22:44348237-44348259 CATTTTACACAGGGGGAAGCAGG - Intergenic
949713953 3:6906275-6906297 CTGTTATCTCACTGGGCAGCTGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950347344 3:12308781-12308803 CTATTTTCTCAGTGGCATGCTGG - Intronic
950622266 3:14215393-14215415 CCATTTTCACAGTGGGAAGCTGG - Intergenic
951350076 3:21596190-21596212 CAGTTTTCACAGCGGCAAGGAGG + Intronic
952531299 3:34264808-34264830 ATGTTTCCACAGGGAGAAGCTGG - Intergenic
953153363 3:40345252-40345274 CTTTTTTCACATTGGCAACCTGG + Intergenic
954946492 3:54429501-54429523 CTGTTTTCACAGGAGAATGCTGG + Intronic
956490354 3:69764911-69764933 TTGTTTTAACAGTGGGAGTCTGG + Intronic
956576847 3:70761289-70761311 CATTTTTCTCAGTGGGAAACAGG + Intergenic
958536641 3:95412279-95412301 CAGTTTTCACAGTGAGAAGGAGG - Intergenic
960920253 3:122739372-122739394 GTGTTGTCACAGAGGGAAGGAGG - Intergenic
961186417 3:124918889-124918911 CAGTTTTCATGGTGGGAGGCTGG - Intronic
962245861 3:133791751-133791773 CTCTTTTCACAGTGGCAGCCTGG + Intronic
962592210 3:136902637-136902659 ATGTGTTCACAGTGGGGTGCTGG + Intronic
962977819 3:140461354-140461376 CTGTTGTCTCATTGGGATGCTGG - Intronic
964225956 3:154402250-154402272 CAGTTTTTAAAATGGGAAGCAGG + Intronic
966422338 3:179745859-179745881 TTGTTTTCACATTGTGAGGCTGG + Intronic
968553206 4:1234737-1234759 CGGTTTTCTCATTGGGAAGCTGG - Intronic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
969254294 4:5991959-5991981 CTCTTTTCTCTGTGGGCAGCTGG - Intergenic
969374363 4:6753410-6753432 CTGTTTTCAGATGGGGAATCTGG - Intergenic
969677502 4:8622115-8622137 CAGCTTTCACACTGGAAAGCAGG - Intergenic
969678457 4:8627756-8627778 CAGCTTTCACACTGGAAAGCAGG - Intergenic
969679413 4:8633390-8633412 CAGCTTTCACACTGGAAAGCAGG - Intergenic
970990135 4:22203590-22203612 CTGTTTTCACTGTGAGAACATGG - Intergenic
972591924 4:40496076-40496098 CTTTTTTCTCAGAGGAAAGCAGG - Intronic
979188214 4:117824954-117824976 CTGTTTTCAAAGAGGAAAGGTGG + Intergenic
979465450 4:121032512-121032534 TTGTTTTGAAAGTGGGAAGTAGG - Intergenic
981459003 4:144990560-144990582 CTGTTCTCACCGTGTGATGCTGG - Intronic
981631917 4:146829223-146829245 CTGTTTTCCCAGTTGGAAACTGG - Intronic
984441743 4:179779527-179779549 CTGTTTTCTCTCTGGGGAGCTGG + Intergenic
984575060 4:181438424-181438446 CTGTGATCTCACTGGGAAGCAGG + Intergenic
985024153 4:185722907-185722929 ATGTCATCACAGTGGGAAGAAGG + Intronic
985323612 4:188741998-188742020 TTGTATACACAGTGGAAAGCTGG - Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
993497757 5:88627083-88627105 CTGTTTTAACAGTGGGAGACTGG + Intergenic
994236163 5:97365551-97365573 CTGTGTTCAGAGTGGGAACAGGG + Intergenic
994743776 5:103653643-103653665 CTGCTTTCACAAAGGAAAGCAGG + Intergenic
995377144 5:111487821-111487843 CAGTTTTCACATTGAGGAGCTGG + Exonic
995695794 5:114876813-114876835 CTGTTTTCAGAGTGTCAGGCAGG - Intergenic
996205574 5:120731382-120731404 CTGTTGTCACAGTGGTGTGCTGG + Intergenic
997224015 5:132195251-132195273 CTTTCTTCACAGGGAGAAGCTGG + Intronic
997673420 5:135694948-135694970 ATGTTTTCTCAGTGAGGAGCTGG - Intergenic
998838743 5:146230800-146230822 GTGTTTTCAGAGTGGTGAGCAGG - Exonic
999296776 5:150464643-150464665 CTGCTCTCACACTGGGAAGTCGG + Intergenic
999401407 5:151267178-151267200 CTGTTTTGAGAATGGGAAGAGGG + Intronic
1001266901 5:170280290-170280312 CTGTTCTCTCAGTGGGACCCTGG + Intronic
1002494019 5:179599654-179599676 CTGTTTTCCCAGAGGGGAGGAGG + Intronic
1002692192 5:181058223-181058245 CAGTTGTCACAGTGGGAATGGGG + Intronic
1002931680 6:1639289-1639311 CTACCTTCACAGTGGGACGCAGG + Intronic
1004561174 6:16752480-16752502 CTGTCTTCACAGTTTCAAGCAGG + Intronic
1005657275 6:27953647-27953669 CTGTAATCCCAGCGGGAAGCTGG - Intergenic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1006905643 6:37531655-37531677 TTGTCTTCAGAGAGGGAAGCTGG + Intergenic
1007353190 6:41290547-41290569 CTCTTTTCACAATGGCAGGCTGG - Intergenic
1008415132 6:51230646-51230668 CAGTTTTCTCAGTGGGAAAGAGG - Intergenic
1009937656 6:70252422-70252444 CTGCTTTCACACTGAGAATCTGG + Intronic
1010517876 6:76796445-76796467 TTGTTTTCACTATGGTAAGCAGG + Intergenic
1011045065 6:83072550-83072572 CTTATTTTACAGTGAGAAGCAGG - Intronic
1012077557 6:94710823-94710845 ATGTTTTCACAGCTGCAAGCAGG - Intergenic
1012234537 6:96798180-96798202 TTGTTTTCATAGTGGGAATCAGG - Exonic
1012477516 6:99630841-99630863 TTGTTGGCACAGTTGGAAGCTGG + Intergenic
1012636091 6:101543979-101544001 CTGTGATCTCAGTGGGACGCTGG + Intronic
1012864117 6:104596989-104597011 CTGTTTTCTCAGTCGGAAAATGG - Intergenic
1012954985 6:105560168-105560190 ATGTTCTTAGAGTGGGAAGCTGG + Intergenic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1013221370 6:108080573-108080595 TGGCTTTCACAGTGGGAGGCTGG - Intronic
1014998992 6:128191096-128191118 ATGATTTCACAGTGGTAAGTAGG + Intronic
1016015214 6:139176952-139176974 CTGTAAGCACTGTGGGAAGCCGG + Exonic
1017159108 6:151348979-151349001 CTTTCTTCACAGTGAGTAGCTGG - Exonic
1017312240 6:152987370-152987392 TTGTATACACAGTGGAAAGCTGG + Exonic
1017410957 6:154167328-154167350 ATGTTTTCACAATGGGAATAAGG - Intronic
1018381220 6:163259965-163259987 CTGGTTTCAGAGTTGGAAGAGGG + Intronic
1018640225 6:165898217-165898239 CTGTTTTTACACTGAGAAGGTGG + Intronic
1020073302 7:5241459-5241481 CTGTTATCTCCGTGGGATGCAGG - Intergenic
1022993732 7:35732850-35732872 GAGTTGTCACAGTGGAAAGCAGG + Intergenic
1024852771 7:53740914-53740936 CTGTTTTAACAGGTGCAAGCTGG - Intergenic
1028598961 7:92580054-92580076 CTGTTTTCCTTCTGGGAAGCTGG + Intronic
1029363431 7:100102509-100102531 CCCTTTCCACATTGGGAAGCTGG + Intronic
1029400575 7:100342869-100342891 CTGGGTTCACACTGGGAACCCGG + Intronic
1031930968 7:127685629-127685651 CTCTTTTCACAGTTGCAAGTGGG + Intronic
1033622675 7:143076394-143076416 CTGTCTGCCTAGTGGGAAGCGGG + Intergenic
1034362541 7:150513424-150513446 CAGTTTTCACTGTTGGCAGCTGG - Intergenic
1034944371 7:155252460-155252482 CTGTTCACACAGTGGGAAGGAGG + Intergenic
1035489603 7:159261814-159261836 CTGTTGTCACTGTGTGAAGATGG + Intergenic
1036069450 8:5424537-5424559 CTTGTTTCTCATTGGGAAGCTGG - Intergenic
1036570308 8:9974478-9974500 CTGTTTTAACATTGGTAAACTGG + Intergenic
1036591691 8:10174234-10174256 CTCTTTACAAAGTTGGAAGCAGG - Intronic
1037983051 8:23268857-23268879 CAATTTTCAGAGTGGGAAGCGGG + Intergenic
1038141680 8:24851792-24851814 CGATTTTCATAGTGGGAAGAAGG + Intergenic
1038152876 8:24958077-24958099 CTGTTTTCAAATAGAGAAGCCGG + Intergenic
1038219890 8:25597295-25597317 CTGTTTTCACCTTGGGACGTAGG + Intergenic
1038698223 8:29825341-29825363 CTGTTTTCACAGTGCGGTGGGGG - Intergenic
1040990802 8:53347532-53347554 CAGTTTTCACAGTGAGAGGGAGG - Intergenic
1041869736 8:62619130-62619152 GTGTTTTCACAGATGAAAGCAGG - Intronic
1046885907 8:119366800-119366822 CTGTTTTCTCAGTGAAAAGGAGG - Intergenic
1047215751 8:122874673-122874695 CTGTTTTCTCAGTGGTAAAATGG - Intronic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048859872 8:138716279-138716301 TTGTTCTCACAGGGAGAAGCAGG - Exonic
1049335397 8:142081887-142081909 CTATTTTCTCTGTAGGAAGCTGG - Intergenic
1050929766 9:11308402-11308424 CAGTTTTCACAGGGAGAAGGAGG - Intergenic
1054972768 9:71107432-71107454 ATGTTTTCACATTGGTGAGCAGG - Intronic
1055493278 9:76827806-76827828 CTGTTTTAAAAATGGGAAACTGG - Intronic
1055658922 9:78481689-78481711 CGATTTTCACAGTGAGAACCTGG + Intergenic
1057264337 9:93604065-93604087 CTGTTTCCAGAGTTAGAAGCTGG - Intronic
1058776844 9:108292964-108292986 CTGCTTTCACTTTGAGAAGCTGG + Intergenic
1060219638 9:121757550-121757572 CATTGTTCACAGTGGGAAACAGG - Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1186840947 X:13484303-13484325 CAGTTTTCACTGTGGGCAACAGG - Intergenic
1186917102 X:14234507-14234529 CTGGATTCACAGTGGCAAGTGGG + Intergenic
1190247611 X:48700797-48700819 CTGTGTTCACAGTGTGCACCCGG + Intronic
1191980523 X:66919624-66919646 CTATTTTCAGACTGTGAAGCAGG + Intergenic
1194689339 X:96963567-96963589 CAGAGTTCACAGTGGGAATCTGG + Intronic
1197565804 X:128084611-128084633 CTCTTTTCACTGTGGCAGGCTGG - Intergenic
1198693896 X:139314965-139314987 TAGTTTTCACCTTGGGAAGCGGG - Intergenic
1199525755 X:148790038-148790060 CTGTTTTCAGAGTGCTAAGTTGG - Intronic
1202149610 Y:21832859-21832881 CTGTCTTCTCAGTGGGACACAGG + Intergenic