ID: 1148918508

View in Genome Browser
Species Human (GRCh38)
Location 17:51005894-51005916
Sequence TGACAGGCTAACAACTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148918503_1148918508 26 Left 1148918503 17:51005845-51005867 CCGTCTCAAAAAAACAGAAAACA 0: 9
1: 383
2: 3286
3: 101539
4: 86034
Right 1148918508 17:51005894-51005916 TGACAGGCTAACAACTGGAGGGG 0: 1
1: 0
2: 3
3: 29
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148918508 Original CRISPR TGACAGGCTAACAACTGGAG GGG Intronic
902822890 1:18954413-18954435 GGACAGGCTAGCAACTGGGTAGG - Intronic
904436977 1:30505382-30505404 TCACAGGCTCACAGCTGGAAGGG + Intergenic
907919109 1:58896490-58896512 TGAAGGCCTGACAACTGGAGAGG - Intergenic
908035075 1:60043003-60043025 GGATAGGCTAACAAGTGGAGAGG + Intronic
908339779 1:63164954-63164976 TGACAGGTAAAGAGCTGGAGAGG - Intergenic
911830526 1:102545370-102545392 TCATAGGCTTACAGCTGGAGAGG - Intergenic
912278740 1:108290225-108290247 TCACAGGTTCACAGCTGGAGAGG - Intergenic
912289486 1:108404132-108404154 TCACAGGTTCACAGCTGGAGAGG + Intronic
912834683 1:112985873-112985895 TCACAGGCTCACAACGGGAGAGG - Intergenic
913330967 1:117667125-117667147 AGCCAGGCTGACAAATGGAGAGG - Intergenic
913566986 1:120082040-120082062 TGACAAGCTAACAAGTGGTAGGG + Intergenic
913631144 1:120711509-120711531 TGACAAGCTAACAAGTGGTAGGG - Intergenic
913675367 1:121135811-121135833 TGACACAGTCACAACTGGAGTGG + Intergenic
914027260 1:143923752-143923774 TGACACAGTCACAACTGGAGTGG + Intergenic
914287738 1:146242746-146242768 TGACAAGCTAACAAGTGGTAGGG + Intergenic
914548772 1:148693492-148693514 TGACAAGCTAACAAGTGGTAGGG + Intergenic
914617908 1:149378222-149378244 TGACAAGCTAACAAGTGGTAGGG - Intergenic
916281414 1:163055359-163055381 TGACAGGATAAAAACTTGAAAGG - Intergenic
916892051 1:169121638-169121660 TGAGAGGCAAACCACTGGAGAGG + Intronic
920462731 1:206154648-206154670 TGACACAGTCACAACTGGAGTGG + Intergenic
920477524 1:206290908-206290930 AGAGATGCTATCAACTGGAGAGG - Intronic
920512727 1:206562798-206562820 TGGCAGGCTAACTACTTGGGAGG + Intronic
920831495 1:209469832-209469854 TCACAGGCTTATAGCTGGAGGGG - Intergenic
920933778 1:210412449-210412471 TCACAGGCTCACAGCTGAAGGGG - Intronic
923405526 1:233655304-233655326 TCACAGGCTCACAGCTGGAGGGG + Intronic
1062971133 10:1650395-1650417 TGACAAGCTAAGTACTCGAGGGG + Intronic
1063479127 10:6356224-6356246 TGACTTTCTAACTACTGGAGGGG - Intergenic
1065281454 10:24143233-24143255 TGAGGGGATAACAACTTGAGTGG - Intronic
1067364496 10:45612490-45612512 TCACAGGTTCACAGCTGGAGAGG + Intergenic
1069543968 10:69316120-69316142 TGAGCGGCGAACAAATGGAGTGG + Intronic
1069987465 10:72294174-72294196 TGACAGGCTAAAAACTGGCGGGG - Intergenic
1071884076 10:89930609-89930631 TCACAAGCTCACAGCTGGAGAGG + Intergenic
1072436770 10:95421323-95421345 TGACAAAGTAACAACAGGAGAGG + Intronic
1073629559 10:105134928-105134950 TCACAGGCTTGCAGCTGGAGGGG - Intronic
1074036794 10:109747267-109747289 TGACAGAAAAACAACTGCAGTGG - Intergenic
1074619822 10:115107235-115107257 TCACAGGCTCACAGCTGGAAGGG - Intronic
1075316799 10:121459556-121459578 GGACTGGGTAACAACTGGTGTGG + Intergenic
1080437726 11:32261825-32261847 TTACAGGCTCACAGCGGGAGGGG - Intergenic
1082212853 11:49526442-49526464 TGACAGGCTACCACCAGAAGAGG - Intergenic
1083260452 11:61519710-61519732 TGAGACGCTAACAACTGGGGAGG + Intronic
1086636743 11:89098068-89098090 TGACAGGCTACCACCAGAAGAGG + Intergenic
1087298076 11:96400339-96400361 TCACAGGCTTACAGCTGGATAGG + Intronic
1087756845 11:102063411-102063433 TCACAGGTTTACAGCTGGAGAGG + Intronic
1090729277 11:129555656-129555678 TCATAGGCTCACAGCTGGAGGGG + Intergenic
1092318691 12:7447513-7447535 TCACAGGTTCACAACTGGAAAGG + Intronic
1093038781 12:14356292-14356314 TCACAGGCTCACAGCTGGAAAGG + Intergenic
1095381219 12:41595726-41595748 TTACAGGCTGACAGCTGCAGAGG - Intergenic
1096516634 12:52159637-52159659 TCACAGGCTCACAGATGGAGGGG - Intergenic
1096623483 12:52879089-52879111 TGAAAGGCTCACAAGTGGATGGG + Intergenic
1097039184 12:56144293-56144315 TAAGAGGCTCACAGCTGGAGAGG - Intronic
1097838352 12:64296484-64296506 TTACAGGCTGACAACTGGAGAGG + Intronic
1100278261 12:93092447-93092469 TGACAGGAAAACAAATGAAGTGG + Intergenic
1103289585 12:119833957-119833979 AGACTGGCTAAAAACTGGATGGG + Intronic
1106893096 13:34267576-34267598 TCACAGGCTAACAACTGATCAGG - Intergenic
1108761607 13:53573153-53573175 TGACAAGATAACAAGTGGAAAGG + Intergenic
1109330058 13:60918287-60918309 TCACAGACTCACAGCTGGAGAGG - Intergenic
1109922586 13:69088276-69088298 TCACAGGCTCACAGCTGGAGGGG + Intergenic
1110230691 13:73164472-73164494 TGACACCCTACAAACTGGAGGGG - Intergenic
1110472977 13:75881330-75881352 GGTCAGGCTAACCACAGGAGAGG - Intronic
1111228924 13:85314813-85314835 TGTCAGGCAAACAACAGAAGGGG + Intergenic
1112673491 13:101670009-101670031 TGGCAGAGTAACAACTGGAGGGG - Intronic
1112826355 13:103397101-103397123 TCACAGGTTCACAGCTGGAGAGG - Intergenic
1113642152 13:111965353-111965375 TGACGGGCTGATAAGTGGAGCGG - Intergenic
1117305402 14:54468810-54468832 TCACAGGCTCGCAGCTGGAGGGG + Intergenic
1117679775 14:58191897-58191919 TTACAGGCCAACACCTAGAGAGG - Intronic
1117780248 14:59224517-59224539 TCACAGGCTTACAGCTGGAAGGG + Intronic
1117832699 14:59768581-59768603 TGATAGGGTAGAAACTGGAGTGG - Intronic
1119128043 14:72146510-72146532 TCACAGGCTCACAGCTGGAGGGG - Intronic
1119508642 14:75193934-75193956 TCACAGGCTCTCAACTGGAGAGG + Intergenic
1121382808 14:93489434-93489456 TCATAGGCTCACAGCTGGAGAGG - Intronic
1123677552 15:22726015-22726037 TGACATGGTCAGAACTGGAGAGG - Intergenic
1124329758 15:28800278-28800300 TGACATGGTCAGAACTGGAGAGG - Intergenic
1125043555 15:35220992-35221014 TCACAGGCTCACAGCTGGAGAGG - Intronic
1127239675 15:57098891-57098913 TGAAAGAATAAGAACTGGAGAGG + Intronic
1131915073 15:97256196-97256218 TGAGAGGTTAAGAACTGGTGAGG + Intergenic
1133844473 16:9441154-9441176 TGACAGGATAACACATGGGGAGG - Intergenic
1135818123 16:25654797-25654819 TGACAGTCTAAGAACTGAAGTGG + Intergenic
1141690000 16:85591305-85591327 TGACAGGGTAGCAACTGGAGGGG - Intergenic
1142323143 16:89397765-89397787 TGACAGGCAAGGGACTGGAGTGG + Intronic
1146082133 17:29789948-29789970 TCACAGGTTCACAGCTGGAGAGG + Intronic
1148461079 17:47839359-47839381 TGACAGGCTTGCACCTGGATCGG + Intronic
1148918508 17:51005894-51005916 TGACAGGCTAACAACTGGAGGGG + Intronic
1151082782 17:71347320-71347342 TTACAGGCTCACAGCTGGAGAGG + Intergenic
1157864173 18:51166692-51166714 TGCCAGAGTAACAACTGGGGAGG - Intergenic
1159781834 18:72668562-72668584 TCACAGACTCACAGCTGGAGAGG + Intergenic
1161232572 19:3181959-3181981 TGACAGTCTCACAGATGGAGAGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167806383 19:51789176-51789198 TAACAGGCTTACAGCTGAAGAGG - Intronic
925812359 2:7712910-7712932 TGGCAGGCACACAACTGGAATGG + Intergenic
928825858 2:35420211-35420233 TCACATACTATCAACTGGAGGGG + Intergenic
930239434 2:48921149-48921171 TCATAGGCTCACAGCTGGAGGGG - Intergenic
931496608 2:62813886-62813908 TCACAGGTTCACATCTGGAGAGG + Intronic
934569383 2:95359256-95359278 TCACAGGCTCACAGCTGGAGAGG - Intronic
936786904 2:116104269-116104291 AGACAGGCTGAAACCTGGAGTGG + Intergenic
936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG + Intergenic
936813358 2:116429468-116429490 AGACAGGATAAGAAATGGAGTGG + Intergenic
938119376 2:128623031-128623053 TGACTGGCAAACCAATGGAGAGG - Intergenic
938139713 2:128785504-128785526 TGTCAGCCTCACACCTGGAGAGG - Intergenic
940093857 2:149951932-149951954 TCACAGGCTCACACCTGGAGGGG - Intergenic
940389955 2:153120814-153120836 TGCCAGGCTCACAGCTGGAGGGG + Intergenic
942769696 2:179502181-179502203 TGACAGGCTTACAGGTGGAAGGG + Intronic
943108199 2:183572664-183572686 TTACAGGCTCATAACTGGAAGGG + Intergenic
946543892 2:220715767-220715789 TTACAGGCTCATAAGTGGAGGGG - Intergenic
947313304 2:228827774-228827796 TGATAGGATAAAAACAGGAGGGG - Intergenic
948872493 2:240810501-240810523 TAACATGGTAACATCTGGAGGGG + Intronic
1169761052 20:9094759-9094781 TGACATAGTAACAACTGGGGTGG - Intronic
1170188077 20:13615061-13615083 TGACATGGTCAGAACTGGAGAGG + Intronic
1170498608 20:16951323-16951345 TCACAGGTTCACAGCTGGAGAGG + Intergenic
1170963341 20:21044665-21044687 TCACAGGTGAACACCTGGAGGGG - Intergenic
1170999552 20:21397980-21398002 TGAGGGGCTGATAACTGGAGAGG - Exonic
1172061743 20:32191128-32191150 TGGCAGGCTAAGAGCTGGATTGG + Intergenic
1172399974 20:34641577-34641599 CCGCAGGCTAACAGCTGGAGAGG + Intronic
1175323937 20:58109651-58109673 TCACAGGCTCACATCTGGTGAGG + Intergenic
1175970148 20:62682147-62682169 TGACAAGCTAACACCAGTAGTGG - Intronic
1178631128 21:34262315-34262337 TGACAGACCAACAACTGGGCAGG - Intergenic
1178631320 21:34263790-34263812 TGACAGACCAACAACTGGGCAGG - Intergenic
1179131809 21:38644083-38644105 TCCCAGGCTACCACCTGGAGAGG - Intronic
1181614504 22:24043835-24043857 TCACAAGTTTACAACTGGAGAGG - Intronic
1184938679 22:47744306-47744328 ACACAGCCTAACAACTGCAGAGG + Intergenic
952724788 3:36572741-36572763 TCACAGGCTCATAGCTGGAGTGG - Intergenic
953206641 3:40836892-40836914 TCACAGGCTTACAGCTGGAGGGG - Intergenic
955151499 3:56371723-56371745 TGACAGGCTAGCCAAGGGAGGGG - Intronic
957888042 3:86316286-86316308 TCACAGGTTCACAGCTGGAGAGG + Intergenic
959155042 3:102657013-102657035 TGATAGCTTAACAACTGGAAAGG - Intergenic
959378062 3:105609011-105609033 TCATAGGCAAGCAACTGGAGTGG - Intergenic
961013670 3:123450957-123450979 TGACAGTCTAAACCCTGGAGAGG + Intergenic
963146524 3:142000680-142000702 TCACAGACTCACAGCTGGAGGGG - Intronic
964306584 3:155347588-155347610 TCACAGGCTCACTGCTGGAGAGG - Intergenic
966338957 3:178903426-178903448 TCACAAGCTCACAGCTGGAGAGG + Intergenic
968975347 4:3819493-3819515 TCACAGGTTCACAGCTGGAGAGG - Intergenic
972082760 4:35173701-35173723 TTACAGGTTCACAGCTGGAGAGG + Intergenic
974011273 4:56609377-56609399 TCACAGGTTCACAGCTGGAGGGG + Intergenic
975950405 4:79763457-79763479 TCACAGGCTCACAGCTGAAGGGG - Intergenic
976806335 4:89051662-89051684 TCACAGGCTCACAGCTAGAGAGG - Intronic
977667173 4:99654530-99654552 TGCCAGGCAAACAACTGGACAGG - Exonic
978330216 4:107604385-107604407 TGAAAGGCTGACACCTGGAGAGG + Intronic
978980287 4:114936907-114936929 TGACAGAATAACAACTTGAGAGG + Intronic
981516301 4:145613443-145613465 TCACAGGTTCACAACTGGAAAGG + Intergenic
982598275 4:157413531-157413553 TCACAGGCTCACAGCTGGGGTGG - Intergenic
987737889 5:21868715-21868737 TCACAGGCTCACAACTAAAGAGG + Intronic
992888240 5:81180645-81180667 TGAGAGGCTGCCAACTGCAGTGG + Intronic
993348586 5:86818258-86818280 TTTTAGGCTAACAACTGGAAAGG + Intergenic
993792456 5:92224019-92224041 TTACAGGCTCACAAGTGGAAGGG - Intergenic
993943698 5:94093817-94093839 TCACAGGTTTACAGCTGGAGAGG - Intronic
1000905331 5:166959390-166959412 TCGCAGGATCACAACTGGAGTGG - Intergenic
1001351691 5:170974209-170974231 TAACAGGCTGACAGCTAGAGGGG - Intronic
1002773967 6:313080-313102 TGACAGATTAAAAAATGGAGTGG - Intronic
1007693730 6:43718739-43718761 AGACAGGCTGGCGACTGGAGGGG + Intergenic
1007878473 6:45134573-45134595 TCATAGGCTCACAGCTGGAGAGG - Intronic
1008363694 6:50650705-50650727 TTACAGGCTCATAACTGGAAGGG + Intergenic
1008504926 6:52220325-52220347 TCACAGGCTCACATCTGGAAGGG + Intergenic
1010145882 6:72669201-72669223 TCACAGGTTCACAGCTGGAGAGG - Intronic
1010566435 6:77420109-77420131 TCACAGGCTCAAAGCTGGAGGGG + Intergenic
1010713975 6:79207081-79207103 TTACAGGCTCACAAGTGGAAGGG + Intronic
1011935427 6:92770639-92770661 TCACAGGCTCACAGCTGGAGGGG + Intergenic
1014039002 6:116802304-116802326 TAACAGCTTAATAACTGGAGTGG - Intronic
1014227551 6:118864999-118865021 TGACAGCCTAAGAAGTGGACCGG + Intronic
1015926467 6:138314586-138314608 TCACAGGCCCACAGCTGGAGAGG - Intronic
1024104770 7:46071758-46071780 TCACAGGTTCACAGCTGGAGAGG + Intergenic
1024570244 7:50717190-50717212 TGGCAGCCTAACAACTGCAAGGG + Intronic
1028503072 7:91540592-91540614 TCACAGACTCACAGCTGGAGGGG - Intergenic
1028646064 7:93097877-93097899 TTACAGGCTCACAGCTGGAAAGG + Intergenic
1034420978 7:150990555-150990577 TGCCAGGCTCACACCTGCAGAGG + Intergenic
1037261108 8:17009482-17009504 TGAAATGTTAACAACTGGCGGGG + Intergenic
1037424005 8:18734731-18734753 TCACAGGCTTAAAGCTGGAGAGG - Intronic
1038567349 8:28630752-28630774 TGAGAGGCTTATAACTGGGGCGG + Intronic
1039631971 8:39122064-39122086 TCACAGGTTCACAACTGGAGAGG + Intronic
1039632318 8:39125414-39125436 TCACAGGTTCACAACTGGAGAGG + Intronic
1039651084 8:39340090-39340112 GCACAGGCTTACAGCTGGAGAGG - Intergenic
1040823447 8:51590738-51590760 TCACAAGCTTACAGCTGGAGAGG + Intronic
1041158977 8:55018118-55018140 GGACAGGCTAACACCTGGAAAGG + Intergenic
1041654906 8:60339173-60339195 TGAGAGGCTAGCATCTGGGGAGG - Intergenic
1043566964 8:81559305-81559327 TAACAGCCTAACAACTCGGGGGG - Intergenic
1044496901 8:92897155-92897177 TCACAGGCTCACAGATGGAGAGG + Intronic
1044886270 8:96781752-96781774 TCACAGGCTCACAGCTAGAGGGG - Intronic
1046017026 8:108617494-108617516 AGACAGGCTGACAAATGGACAGG - Intronic
1048892711 8:138962122-138962144 TCACAGGTTCACAGCTGGAGAGG + Intergenic
1049836914 8:144741727-144741749 TGACAGACTAACAGCTGAATGGG + Intronic
1050067059 9:1771298-1771320 TCACAGGCTTACAGCTGGAGGGG - Intergenic
1050371283 9:4924002-4924024 TCACAGGGTCACAAGTGGAGTGG + Intergenic
1053369758 9:37550990-37551012 TTATAGGCTCACAGCTGGAGGGG - Intronic
1055158486 9:73095270-73095292 TTACAGGCTCACAGCTGAAGGGG - Intergenic
1055840158 9:80493943-80493965 TTACAGGCTCACGGCTGGAGAGG - Intergenic
1056281580 9:85046126-85046148 TCACAGGCTCACAGCTGGAGAGG + Intergenic
1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG + Intronic
1057969897 9:99544926-99544948 TCACAGGCTCACAGCTGGAGGGG - Intergenic
1060482068 9:124022540-124022562 GGACAGCCTCACAACAGGAGGGG + Intronic
1060766272 9:126296807-126296829 AGAGAGGCTTAGAACTGGAGTGG - Intergenic
1185961998 X:4554588-4554610 ATACAGTCTAAAAACTGGAGAGG - Intergenic
1186752469 X:12635454-12635476 TACCAGCCTAACAACTCGAGGGG + Intronic
1189254033 X:39623606-39623628 TCACAGGCTCACAGCTGGAGAGG - Intergenic
1190481419 X:50880904-50880926 TCACAGGTTCACAGCTGGAGAGG - Intergenic
1193879690 X:86906954-86906976 TCACAGGCTCACAGATGGAGAGG - Intergenic
1194189914 X:90822114-90822136 TGACAGACTTACAGCTAGAGAGG + Intergenic
1195292517 X:103442648-103442670 TCACAGGCTCACATCTGGAGAGG + Intergenic
1197599344 X:128508841-128508863 TTAAAGGCTCACAGCTGGAGAGG + Intergenic
1199286308 X:146058313-146058335 TGACAGGCTTACAACAAGTGTGG - Intergenic
1199381567 X:147178342-147178364 TGACAGGTTCACAGCTGGAGAGG + Intergenic
1200536516 Y:4404227-4404249 TGACAGACTTACAGCTAGAGAGG + Intergenic