ID: 1148922022

View in Genome Browser
Species Human (GRCh38)
Location 17:51045732-51045754
Sequence AGCCATCTTCTGTATTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148922022 Original CRISPR AGCCATCTTCTGTATTTTAG AGG (reversed) Intronic
900925329 1:5702485-5702507 AATCATGTTCTGTATTTTTGGGG + Intergenic
902223780 1:14983424-14983446 AGCCAGCTGGTGTACTTTAGGGG - Intronic
902905205 1:19551562-19551584 AGCTATTTTTTGTATTTTAGTGG - Intergenic
904243562 1:29168327-29168349 GGCCTTCTACTGTATTTTAAAGG + Intronic
904763953 1:32827643-32827665 AGCTAATTTTTGTATTTTAGTGG + Intronic
910279657 1:85484786-85484808 AGCCAACTTCTACATTTTGGTGG - Intronic
910896679 1:92077246-92077268 AGCCATGTTTTGTTTTTTAAGGG + Intergenic
911656293 1:100447813-100447835 AGCTTTCTTCTGTTTTTTTGGGG + Intronic
912082420 1:105952713-105952735 AGCCATCTTCTTCTTTTTAATGG + Intergenic
912208059 1:107530039-107530061 AGCCATATTCTGTTTTTTGTGGG - Intergenic
913663315 1:121023961-121023983 AGCTAATTTTTGTATTTTAGTGG - Intergenic
914014702 1:143807226-143807248 AGCTAATTTTTGTATTTTAGTGG - Intergenic
914163118 1:145153975-145153997 AGCTAATTTTTGTATTTTAGTGG + Intergenic
914653327 1:149715783-149715805 AGCTAATTTTTGTATTTTAGTGG - Intergenic
915216279 1:154342776-154342798 AGCCTTCTTATGTGTTTCAGAGG + Exonic
916988595 1:170218150-170218172 AGTCATCTTCTCTATGCTAGAGG - Intergenic
918749644 1:188257097-188257119 AGTTATCTTTTGTATTTCAGTGG + Intergenic
919631770 1:199966464-199966486 AGCTAGTTTTTGTATTTTAGTGG - Intergenic
922325083 1:224520991-224521013 AGCCATCTTGTGGACTGTAGGGG - Intronic
923904510 1:238368849-238368871 AGCTAATTTTTGTATTTTAGTGG + Intergenic
924071448 1:240284475-240284497 AGCTATCATCTGTATTCTAGTGG - Intronic
1062935506 10:1383113-1383135 AGCAATTTTATGTATTTTAGGGG + Intronic
1063792874 10:9474698-9474720 AGTTTTCTTCTGCATTTTAGGGG + Intergenic
1064361797 10:14672250-14672272 AGCTAATTTTTGTATTTTAGTGG + Intronic
1064440500 10:15349201-15349223 AGCCCTGTTCTGTATTTTCTAGG - Intronic
1065470683 10:26078310-26078332 AGTGATCTTTTGTATTTCAGTGG + Intronic
1065571657 10:27076678-27076700 AGCTATCTTTTGTATTTCGGTGG - Intronic
1065887302 10:30090054-30090076 TGCCATCATCTTTAGTTTAGAGG + Intronic
1066570287 10:36763574-36763596 TGCCATTTTTTGTATTTTAATGG - Intergenic
1066972725 10:42328859-42328881 AAGCATCTTTTGTATTTTTGTGG + Intergenic
1069070616 10:63987636-63987658 AACCTTCATCTGTATTCTAGTGG - Intergenic
1069363298 10:67669143-67669165 AGCCCACTGCTGTAATTTAGGGG - Intronic
1072164128 10:92795973-92795995 AATGATCTTTTGTATTTTAGTGG - Intergenic
1073606134 10:104897464-104897486 AAGCATCTTATGCATTTTAGTGG - Intronic
1073701546 10:105933336-105933358 AGCCATTTTGTGTCTTTTTGTGG - Intergenic
1074568958 10:114607224-114607246 AGCTAATTTTTGTATTTTAGTGG + Intronic
1076437559 10:130456572-130456594 AGCCATCTCCTATTTTTTAAAGG + Intergenic
1077470506 11:2757032-2757054 TGCCTTCTTTTTTATTTTAGGGG - Intronic
1077749098 11:4943866-4943888 AAAGATCATCTGTATTTTAGGGG - Intronic
1078229887 11:9431036-9431058 AGCCATTTTATGCTTTTTAGAGG + Intronic
1078253194 11:9635402-9635424 ATCCAACTTTTGTATTTTATTGG - Intergenic
1079791404 11:24744519-24744541 AGTGATCTTTTGTATTTCAGTGG + Intronic
1081666606 11:44920364-44920386 AGCCATGCACTGTATTTTGGAGG + Intronic
1083087814 11:60168559-60168581 AGCCAACTTCTCCATTTCAGAGG + Intergenic
1083180668 11:60982737-60982759 AGCCATCTCCTGTTTGTCAGAGG + Intronic
1083690976 11:64408747-64408769 AGCCAACTTTTGTATTTTTTTGG - Intergenic
1086093815 11:83030631-83030653 AGCTAACTTTTGTTTTTTAGTGG - Intronic
1086537415 11:87864916-87864938 ATCCAGCTTCTGTATTTGAAAGG + Intergenic
1087106111 11:94408980-94409002 AGTGATCTTTTGTATTTTGGTGG - Intergenic
1088583854 11:111341901-111341923 AGCTATCTTCACTATTTGAGGGG + Intergenic
1089107655 11:116026973-116026995 AATGATCTTTTGTATTTTAGTGG - Intergenic
1090815118 11:130286518-130286540 AGCAATCTTCTGTAGTTCAAAGG - Intronic
1091017106 11:132061758-132061780 AAGCATCTTCTGTATTTGTGTGG + Intronic
1091557985 12:1590205-1590227 ATCCATCTTCTGTTTCTTTGGGG - Intronic
1092702460 12:11247433-11247455 TTCCATCTTCTGTCGTTTAGTGG + Intergenic
1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG + Intergenic
1093948073 12:25133539-25133561 AGCCATCTTCTGTGCTGAAGGGG - Intronic
1094208833 12:27869187-27869209 AGCTAATTTCTGTGTTTTAGTGG - Intergenic
1097355412 12:58595275-58595297 AGCTATCTTCTTTATATTACAGG + Intronic
1097394117 12:59053105-59053127 AGCCGCCTTCTGTGTTTTCGTGG + Intergenic
1098325580 12:69298541-69298563 AGCCTTCATCTGTATTTCAGAGG + Intergenic
1098625785 12:72665327-72665349 ATCCTTTTTCAGTATTTTAGTGG + Exonic
1098903897 12:76141607-76141629 AGGTATCTACTGTATTTTATAGG + Intergenic
1098948239 12:76611474-76611496 TGGTATCTTCTGGATTTTAGAGG + Intergenic
1099381511 12:81958858-81958880 AGCAATGTTCTGTATTTTCTAGG + Intergenic
1099739658 12:86617424-86617446 ATCCATTTTGTGTTTTTTAGTGG - Intronic
1100117275 12:91322135-91322157 AGCTATCTTCTGTATTATTTTGG + Intergenic
1101241915 12:102847588-102847610 AGACATCTTGTGAGTTTTAGTGG + Intronic
1101555827 12:105808360-105808382 AGCCATCTTGTGATTTTAAGGGG + Intergenic
1101634994 12:106532582-106532604 AATAATCTTTTGTATTTTAGTGG + Intronic
1102190651 12:110985394-110985416 TGCCTTCTTAGGTATTTTAGTGG + Intergenic
1103453842 12:121049326-121049348 AGCTCACTTTTGTATTTTAGTGG - Intergenic
1106043918 13:26119889-26119911 GCCCATCTTCTGTTTTTAAGAGG + Intergenic
1106494845 13:30266164-30266186 AGCTAATTTCTGTATTTTTGTGG + Intronic
1106937331 13:34737669-34737691 ACCCAGCTTCTGTATGTTTGTGG - Intergenic
1107525519 13:41227484-41227506 AGCCAGCTTCTGCATTTGGGTGG + Intronic
1111684752 13:91488215-91488237 ACTGATGTTCTGTATTTTAGGGG + Intronic
1111748041 13:92294509-92294531 AGTGATCTTCTGTATTTCTGTGG + Intronic
1113562110 13:111289805-111289827 AACCATTTTCAGTATTTTACTGG + Intronic
1114874443 14:26698212-26698234 ACCCAACTTCTGACTTTTAGTGG + Intergenic
1118691670 14:68345822-68345844 AGCTAATTTTTGTATTTTAGTGG + Intronic
1119888138 14:78161764-78161786 AGCCATCATCTTTAGCTTAGAGG + Intergenic
1121194364 14:92056700-92056722 ATCCATCTTCTGTATTCTTCAGG - Exonic
1121225404 14:92318348-92318370 AGCCCTCTTCTGTATATTTATGG - Intergenic
1121934198 14:98001872-98001894 CACCATTTTCTGTATTTTTGGGG + Intergenic
1122310162 14:100789221-100789243 AGCCATCCTCTGGATTCCAGGGG - Intergenic
1122644516 14:103184783-103184805 AGCTAAATTTTGTATTTTAGTGG - Intergenic
1122845251 14:104491933-104491955 AGACATCTTATAGATTTTAGTGG - Intronic
1123697714 15:22891124-22891146 GGCCATCTTTAGTGTTTTAGGGG - Intronic
1123811323 15:23929392-23929414 AGCTAATTTTTGTATTTTAGTGG + Intergenic
1124346104 15:28922572-28922594 AGCCATGCTCTGTCCTTTAGTGG + Intronic
1124651791 15:31479432-31479454 AGGCATCTACTGTATGTTTGGGG - Exonic
1127567602 15:60207877-60207899 AGACAGATTCTGTATTTTAATGG - Intergenic
1131031784 15:89192383-89192405 AGCCTTCTTTTTCATTTTAGTGG - Intronic
1131760790 15:95620429-95620451 AGCCATCTTCTTTCTTTTTATGG + Intergenic
1133417556 16:5618302-5618324 AGCCATCTCCTGTATATGATTGG - Intergenic
1135522767 16:23189904-23189926 AGCTAATTTTTGTATTTTAGTGG - Intronic
1136246224 16:28977817-28977839 AGGCATCTCCTGTGCTTTAGTGG + Intronic
1137783709 16:51119753-51119775 AGCCTTCTGCAGTATTTTATGGG - Intergenic
1139266637 16:65645929-65645951 ACCCATCTTTTCTATATTAGAGG - Intergenic
1139407394 16:66729943-66729965 AGCTAATTTTTGTATTTTAGTGG + Intronic
1140635572 16:76909119-76909141 AGCCAACATCTGTATTTTGAAGG + Intergenic
1143317729 17:6045399-6045421 ATTCATCTTTTCTATTTTAGGGG - Intronic
1143447705 17:7018868-7018890 AGATAACTTCTGGATTTTAGGGG - Intergenic
1146197073 17:30823017-30823039 AGACATCATTTGCATTTTAGTGG - Intronic
1148370073 17:47092582-47092604 AGCTAATTTTTGTATTTTAGTGG - Intergenic
1148922022 17:51045732-51045754 AGCCATCTTCTGTATTTTAGAGG - Intronic
1149083826 17:52690321-52690343 ATCCATATTATGTATTTTTGTGG - Intergenic
1149324048 17:55511533-55511555 AGACAGCTTCTGTGTTTTGGTGG - Intergenic
1152529214 17:80907277-80907299 CTCCATCTTCTTTATTTTTGGGG - Intronic
1153361614 18:4204268-4204290 AGCAATCTGCTGTGTTTTTGAGG - Intronic
1155604047 18:27582976-27582998 AGTCATCTTCTCTTTTTTGGGGG + Intergenic
1155802499 18:30126037-30126059 AGCTAATTTTTGTATTTTAGTGG - Intergenic
1156205799 18:34884199-34884221 TGTCACCTTCTGTATTTCAGTGG + Intronic
1156414088 18:36869185-36869207 AGGCATTCTCTGAATTTTAGTGG + Intronic
1156802826 18:41138618-41138640 AGCCAACTTCTATATTTTTAGGG - Intergenic
1157628135 18:49068810-49068832 AGCCATCTTTTTTATTCTACTGG + Intronic
1158107770 18:53904957-53904979 AGGCATCTTCTGGAGTTTTGGGG - Intergenic
1158698823 18:59728180-59728202 AGCTAATTTTTGTATTTTAGTGG - Intergenic
1158825938 18:61219325-61219347 AGCAATCTACTGTAGTTTACTGG - Intergenic
1158889118 18:61856687-61856709 AGCAATCTTTTGTACTTTTGAGG + Intronic
1159090283 18:63840539-63840561 AGCCATCTTCTGTACAATGGTGG + Intergenic
1159144598 18:64437905-64437927 AATCATCTTCTGGATTTTAATGG - Intergenic
1160130370 18:76219797-76219819 TGCCATCTTCTATTTTTTAGTGG - Intergenic
1164663698 19:30005971-30005993 ATACATCTTCTGAGTTTTAGAGG - Intronic
1167158193 19:47751801-47751823 GGCCCTCATCTGCATTTTAGAGG - Intronic
1168392124 19:56018044-56018066 TCCCATCTTCTGTATTTCTGTGG + Intronic
925651328 2:6092561-6092583 AGCAAGCTTCTGTTTCTTAGAGG - Intergenic
925862472 2:8193333-8193355 GGCCATGTTCTGGAATTTAGTGG - Intergenic
927123486 2:19990531-19990553 AGCCATTTACTGTATTTGATAGG + Intergenic
928526418 2:32146258-32146280 GGCCATTTTCTGTACTTTAATGG - Intronic
930298376 2:49583716-49583738 AGCCATCTCCAGTATTTCATGGG + Intergenic
931301342 2:60981444-60981466 AGCTAATTTTTGTATTTTAGTGG + Intronic
932318480 2:70802258-70802280 AGCACTCTTCTAGATTTTAGGGG - Intergenic
933028452 2:77293462-77293484 AGACATCTTTATTATTTTAGTGG - Intronic
933677381 2:85068809-85068831 AGCCATATTCACTATTATAGGGG - Intergenic
935262495 2:101367473-101367495 AGCCCTCTTTGGTATGTTAGAGG - Intronic
935334161 2:101999628-101999650 GCCCAACCTCTGTATTTTAGAGG + Intronic
935803344 2:106722114-106722136 AGAAATCTTCTGTATTTCAGTGG + Intergenic
937621404 2:123991904-123991926 AGACATTTTCTTTTTTTTAGAGG - Intergenic
940196518 2:151101037-151101059 AGCCTTCTTCTGTTTTTCAAGGG - Intergenic
940196615 2:151102199-151102221 AGACATCTTTTTTATTTTATGGG - Intergenic
941288044 2:163639417-163639439 ATCCATCTTCTGTATAATATAGG + Intronic
942876601 2:180807213-180807235 AGTCCTCATCTGTATTTTACTGG + Intergenic
942914460 2:181286515-181286537 TGCCATAATCTGTATTTTTGAGG - Intergenic
943704950 2:191024650-191024672 AGAAATCTTCTGTCTTATAGTGG + Intergenic
943847791 2:192674050-192674072 AGGCAACTTCTGAATTTCAGTGG - Intergenic
944861624 2:203820625-203820647 AGCCAATTTTTGTATTTTAGTGG - Intergenic
945141821 2:206694964-206694986 AGACATCTTCTGTATATTTTGGG - Intronic
947220453 2:227786834-227786856 AGGCATGGTCTGCATTTTAGGGG + Intergenic
947228972 2:227866457-227866479 ATCCAGATTCTGTATTTTTGAGG - Intergenic
947460804 2:230303239-230303261 AGTGATCTTCTGTATTTCTGTGG - Intronic
1168928408 20:1601332-1601354 AGCCATCTTCTGAGTTTCTGGGG + Intronic
1169654467 20:7907682-7907704 AGCCAGCTTCAGAATCTTAGAGG - Intronic
1173289354 20:41700871-41700893 GGCCAATTTTTGTATTTTAGTGG + Intergenic
1174561133 20:51431630-51431652 AGCCCTCTTTTGTATATTTGAGG - Intronic
1178012133 21:28300889-28300911 TCCCATGTCCTGTATTTTAGTGG - Intergenic
1178307109 21:31500000-31500022 AGCTAATTTTTGTATTTTAGTGG - Intronic
1181426243 22:22842353-22842375 AGCCAAGTTTTGTTTTTTAGAGG + Intronic
1182171993 22:28240235-28240257 AACCATATTCTGTATATTAGAGG + Intronic
1182569550 22:31226364-31226386 AGCTAATTTTTGTATTTTAGTGG + Intronic
1182590877 22:31378633-31378655 AGCTATTTTTTTTATTTTAGTGG - Intergenic
1183389617 22:37537984-37538006 AGCCAGCTGTTGTCTTTTAGAGG + Intergenic
950410754 3:12835141-12835163 AGGCATCTTCTGTAGTATATAGG - Exonic
951029561 3:17866312-17866334 GGCAATCTTCTCTATTTCAGGGG + Intronic
952348252 3:32509066-32509088 AGCTAATTTTTGTATTTTAGAGG - Intergenic
953539732 3:43806660-43806682 AATGATCTTTTGTATTTTAGTGG - Intergenic
953866750 3:46590230-46590252 AATGATCTTCTGTATTTCAGTGG - Intronic
954168408 3:48779614-48779636 AGCTAATTTTTGTATTTTAGTGG - Intronic
954833857 3:53447477-53447499 AGCTAATTTTTGTATTTTAGTGG + Intergenic
955860140 3:63320442-63320464 AGCTATATTCAGTTTTTTAGTGG + Intronic
957476271 3:80728302-80728324 AGTAATCTTTTGTATTTCAGTGG + Intergenic
957481324 3:80799903-80799925 AGTTATCTTTTGTATTTTTGTGG - Intergenic
958451968 3:94284339-94284361 AATCTTCTTATGTATTTTAGTGG + Intergenic
959275052 3:104268126-104268148 AGTGATCTTTTGTATTTCAGTGG + Intergenic
960514332 3:118587218-118587240 AGACATCTTCTTTCTTGTAGTGG - Intergenic
962592002 3:136899861-136899883 AGCCATCCTTTTTTTTTTAGGGG + Intronic
963040650 3:141067290-141067312 GGCCATCTACTGTATTTGAGAGG + Intronic
963362933 3:144300141-144300163 AGCCATTTTATGAATTTTACTGG + Intergenic
964170740 3:153767522-153767544 AGCCATCTTCTCTCTTTGACAGG - Intergenic
966282951 3:178255886-178255908 AGCTTTCTTCTGCATCTTAGAGG + Intergenic
966534605 3:181017498-181017520 AGCTAATTTTTGTATTTTAGTGG + Intergenic
967303337 3:188038095-188038117 AGCAATATTCTGTATTGCAGTGG - Intergenic
970349844 4:15191411-15191433 AGCCTTCTTTTGTAGTTTGGTGG + Intergenic
971182845 4:24346584-24346606 AATCATCTTTTGTATTTCAGTGG + Intergenic
972418488 4:38865685-38865707 AGCAATGCTCTTTATTTTAGAGG + Intergenic
972994289 4:44861094-44861116 AACCATATTCTGTATATAAGTGG + Intergenic
973831245 4:54761664-54761686 AGTGATCTTTTGTATTTCAGTGG + Intergenic
974116544 4:57586157-57586179 GGCCTTCTGCTATATTTTAGGGG - Intergenic
974443691 4:61951699-61951721 AGCTAATTTTTGTATTTTAGTGG - Intronic
975993079 4:80281021-80281043 AGCCAACTTGTGTATTTTGTTGG + Intronic
976782509 4:88776808-88776830 AGCTAATTTTTGTATTTTAGTGG - Intronic
977052426 4:92145989-92146011 AGCCATCTGCTGTCTTCAAGAGG + Intergenic
977824647 4:101516811-101516833 AGCCATTTTAGGTATATTAGCGG + Intronic
978253251 4:106659473-106659495 AGTCATTGTCAGTATTTTAGTGG - Intergenic
980880239 4:138702625-138702647 AGCCATCTGCTGCTTTATAGTGG + Intergenic
982596123 4:157386137-157386159 TGCCATCTTCTGGAATTTAAGGG - Intergenic
983050381 4:163039233-163039255 AGCCATTTTCTAAATTTTATAGG - Intergenic
984130968 4:175875746-175875768 AATGATCTTCTGTATTTTATAGG - Intronic
986414363 5:7513273-7513295 AGCCATCTTCTGTTTAATTGGGG - Intronic
986698982 5:10386478-10386500 AATTATATTCTGTATTTTAGAGG + Intronic
987377640 5:17251288-17251310 AACCATTTTATGTATTTTGGGGG - Intronic
988240373 5:28600172-28600194 AGACAACTTCTTTATCTTAGAGG + Intergenic
989558347 5:42822933-42822955 AGTCATATTCTGTCTTTTATAGG + Intronic
990725618 5:58751016-58751038 AGCTAATTTTTGTATTTTAGTGG + Intronic
991348180 5:65692529-65692551 AGCCATATTCTGGATTTATGTGG - Intronic
992520601 5:77546451-77546473 AGTCATCTTTTGTATTTCTGTGG - Intronic
993117070 5:83732311-83732333 AGCTAATTTTTGTATTTTAGTGG - Intergenic
993364256 5:87017462-87017484 AGCAAACATGTGTATTTTAGTGG - Intergenic
994279710 5:97886524-97886546 GGCTATCCTCTGTATTTGAGTGG - Intergenic
994569207 5:101491973-101491995 GGCTAATTTCTGTATTTTAGTGG - Intergenic
995472737 5:112520427-112520449 AATGATCTTCTGTATTTCAGTGG + Intergenic
996313005 5:122128330-122128352 ATCCATCTTCCCTGTTTTAGAGG + Intergenic
997538237 5:134639475-134639497 AGCCATTTTCAGGAGTTTAGAGG - Intronic
1000447566 5:161342757-161342779 AACCATATTCTGATTTTTAGTGG + Intronic
1002814161 6:663127-663149 AGGGATCTTTTGTATTTCAGTGG - Intronic
1003027807 6:2572623-2572645 AGCTAATTTTTGTATTTTAGTGG - Intergenic
1003029154 6:2586376-2586398 AATCATCTTTTGTATTTCAGTGG + Intergenic
1003582292 6:7351130-7351152 AATGATCTTCTGTATTTCAGTGG - Intronic
1006687335 6:35847076-35847098 AGTCTTGTTCTGGATTTTAGAGG - Intronic
1007571583 6:42895346-42895368 CGCCATCTTCCATATTTTAACGG - Intergenic
1009698997 6:67150626-67150648 AGCCATGTTATTTATTTTAAAGG - Intergenic
1009788598 6:68370412-68370434 AGCCATCATGAGTATCTTAGAGG - Intergenic
1011224587 6:85092888-85092910 AGCCAACTTCTGTTTATCAGAGG - Intergenic
1012090405 6:94887243-94887265 AGCCTTATTATGTATTTTGGGGG + Intergenic
1012101697 6:95096762-95096784 AGCCATTTTGTTTATTTTAAAGG + Intergenic
1015731876 6:136357365-136357387 AACCCTGTCCTGTATTTTAGAGG - Intronic
1019858575 7:3634553-3634575 AGGCATTTTCTATACTTTAGTGG + Intronic
1020687321 7:11311635-11311657 ATCCATCTAATGCATTTTAGGGG - Intergenic
1020786167 7:12575417-12575439 ACCCATTTTCTGGATTTTATGGG + Intronic
1020850204 7:13343531-13343553 AACGATCTTTTGTATTTTTGTGG + Intergenic
1020968771 7:14906615-14906637 AGCTAATTTTTGTATTTTAGTGG + Intronic
1021614941 7:22492705-22492727 AGGCATCTTCTTTATTTTGTTGG + Exonic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1022351221 7:29567054-29567076 AGCCACCTTCTTCATTTGAGAGG - Exonic
1022992487 7:35722182-35722204 AACCATCATCTGCATTTTACAGG + Intergenic
1024960817 7:54973096-54973118 TGACATCCTCTATATTTTAGTGG - Intergenic
1025801049 7:64786316-64786338 AATAATCTTCTGTATTTTTGCGG - Intergenic
1026046831 7:66911584-66911606 TGCTAACTTTTGTATTTTAGTGG - Intergenic
1027140563 7:75654094-75654116 GGCCATGTTCTGTTTCTTAGAGG - Intronic
1028377561 7:90161916-90161938 AGGCATCTTCTTTATTTTGTTGG - Exonic
1029165719 7:98588710-98588732 AGGCATCTTCTTCATTTAAGAGG + Intergenic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030104171 7:105972875-105972897 AGTCATCTTATTTAGTTTAGAGG - Intronic
1030271787 7:107676313-107676335 AGCCATCTTTTCTTTTTTATTGG + Intronic
1031115252 7:117660465-117660487 AGCTAATTTTTGTATTTTAGTGG - Intronic
1031550290 7:123102892-123102914 TGCCTTTTTCTTTATTTTAGTGG - Intergenic
1033259934 7:139834651-139834673 AATGATCTTTTGTATTTTAGTGG - Intronic
1033727087 7:144130084-144130106 AGCCAACTTCTATATTTTGCAGG - Intergenic
1034413748 7:150954565-150954587 AGCCAGCTTCAGTATTCTATAGG - Intronic
1038886366 8:31667272-31667294 ATCCATCTTCTGTATTAGATTGG - Intronic
1039820272 8:41128501-41128523 AGACAGATTCTGAATTTTAGAGG + Intergenic
1040393394 8:46970137-46970159 AGCCATCTCCTTTATTTAAAGGG + Intergenic
1040560013 8:48515253-48515275 ATCCATCTTCTGTCTTTCATGGG - Intergenic
1040745053 8:50632472-50632494 AGCTAATTTTTGTATTTTAGTGG + Intronic
1041257002 8:55987578-55987600 AGCTAAGTTTTGTATTTTAGTGG + Intronic
1041637392 8:60159411-60159433 AATGATCTTTTGTATTTTAGTGG - Intergenic
1043736121 8:83746459-83746481 ATCAATCTCCTGTATTTTATTGG - Intergenic
1043920047 8:85971773-85971795 ATCAATCTTCTGCATTTTGGAGG + Intergenic
1044035712 8:87301030-87301052 AGTGATCTTCTGTATTTCAGTGG - Intronic
1044177434 8:89145825-89145847 ACCCTTTTTCTGTATTTTCGTGG - Intergenic
1044499879 8:92941228-92941250 AGCTAATTTTTGTATTTTAGTGG + Intronic
1045126361 8:99094416-99094438 AGACATCTTCTGTTATTTGGGGG - Intronic
1046150137 8:110212762-110212784 GGCCATCTTCTGGATCTTATTGG - Intergenic
1048316347 8:133365483-133365505 AGCCTTCTTCAGTATTATGGAGG + Intergenic
1048606463 8:135973692-135973714 TCCCATCTTCTGTCTTTTACCGG + Intergenic
1048856343 8:138689549-138689571 AGCTAATTTTTGTATTTTAGTGG - Intronic
1051563248 9:18466845-18466867 AGTGATCTGTTGTATTTTAGGGG + Intergenic
1055375535 9:75645566-75645588 AGGCATCGTCCGTATTCTAGTGG - Intergenic
1055739029 9:79365299-79365321 TGCCATCTTCTCTCTTTTAAAGG - Intergenic
1056299474 9:85226777-85226799 ACCCATCCTCTGTCTTTAAGGGG + Intergenic
1056322458 9:85449194-85449216 AGTGATCTTTTGTATTTCAGTGG + Intergenic
1057004095 9:91540879-91540901 AGTGATCTTTTGTATTTCAGTGG - Intergenic
1058756951 9:108091527-108091549 GCCCATCTTCTTCATTTTAGTGG + Intergenic
1186412869 X:9359264-9359286 AGCCCTCTGCTGTACTTTAAGGG - Intergenic
1186439860 X:9576507-9576529 AGCCAACTTCTATATTTTCCAGG + Intronic
1187542184 X:20207857-20207879 AGCTCTCTTGTGTATTTTAGTGG - Intronic
1188077833 X:25800845-25800867 TGTCATGTTCTGTATCTTAGGGG + Intergenic
1188215999 X:27477720-27477742 CTGCATCTACTGTATTTTAGGGG + Intergenic
1188253456 X:27928822-27928844 ATCCATCATCTGTATGTGAGAGG + Intergenic
1189412428 X:40784573-40784595 ACCCATCTTCTATGTTTCAGTGG + Intergenic
1190137473 X:47809677-47809699 ATCCATCTTCTGTAATTTTCAGG + Intergenic
1193307740 X:79969653-79969675 AATAATCTTTTGTATTTTAGTGG + Intergenic
1194077077 X:89409377-89409399 ATTCATCTTCTGTAATTTAAGGG + Intergenic
1196694629 X:118598511-118598533 AGCCATCATCTCCATTTTATAGG + Intronic
1197384214 X:125783464-125783486 AACCAGTTTCTGAATTTTAGAGG + Intergenic
1198341491 X:135718945-135718967 AGCCACCTTCTCTGTTTTATCGG - Exonic
1198346507 X:135764418-135764440 AGCCACCTTCTCTGTTTTATCGG + Exonic
1198348413 X:135781703-135781725 AGCCACCTTCTCTGTTTTATCGG + Intergenic
1198350317 X:135798967-135798989 AGCCACCTTCTCTGTTTTATCGG + Exonic
1198352225 X:135816239-135816261 AGCCACCTTCTCTGTTTTATCGG + Exonic
1198354133 X:135833507-135833529 AGCCACCTTCTCTGTTTTATCGG + Exonic
1198356043 X:135850757-135850779 AGCCACCTTCTCTGTTTTATCGG + Exonic
1198357956 X:135868035-135868057 AGCCACCTTCTCTGTTTTATCGG + Intergenic
1198359870 X:135885318-135885340 AGCCACCTTCTCTGTTTTATCGG + Exonic
1198366715 X:135947107-135947129 AGCCACCTTCTCTGTTTTATCGG + Intergenic
1199334198 X:146599726-146599748 AGCTAATTTTTGTATTTTAGTGG - Intergenic
1199521222 X:148738428-148738450 AATGATCTTCTGTATTTCAGTGG + Intronic
1201947861 Y:19531292-19531314 AGCCCCCACCTGTATTTTAGAGG + Intergenic