ID: 1148927729

View in Genome Browser
Species Human (GRCh38)
Location 17:51102079-51102101
Sequence CTGATTAGAAAGGTCTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148927725_1148927729 12 Left 1148927725 17:51102044-51102066 CCATTTTATCTGTTACTCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 249
Right 1148927729 17:51102079-51102101 CTGATTAGAAAGGTCTAACATGG 0: 1
1: 0
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148927729 Original CRISPR CTGATTAGAAAGGTCTAACA TGG Intronic
900986959 1:6078693-6078715 CTGATTTAAAAGGTCTGCCAAGG + Intronic
902167026 1:14580870-14580892 CCTATTAGAAAGTTTTAACAGGG + Intergenic
904655886 1:32046711-32046733 CTGAGGAGAAAGGCCTAACTAGG + Intronic
909028089 1:70506288-70506310 ATGATTAGAAAAGTAGAACACGG + Intergenic
909117134 1:71551634-71551656 TTGATTAGCAATGTCTACCACGG - Intronic
911791928 1:102028271-102028293 CTGATAAGAGAGGTTTCACAAGG + Intergenic
918085199 1:181239109-181239131 CTGATTAGACAGGACTAAGAAGG + Intergenic
920836591 1:209516619-209516641 CTGTTTAGGAAGGTCCCACATGG - Intergenic
920921039 1:210297433-210297455 CTGATTCCAAAGGTCTGGCATGG + Intergenic
921252517 1:213311084-213311106 CTGACAAGAAATGTCTTACATGG + Intergenic
924906104 1:248453852-248453874 CTGATCAGGAAGGACTAGCAAGG + Intergenic
924921785 1:248638185-248638207 CTGATCAGGAAGGACTAGCAGGG - Intergenic
1068250785 10:54437047-54437069 CTAATTAGACAGGTGTGACAAGG - Intronic
1071150549 10:82629555-82629577 TTGCTTAGAAAGTTCTACCATGG - Intronic
1071761985 10:88618218-88618240 CTTATTAGAAAGATAAAACAAGG - Intergenic
1075941110 10:126390745-126390767 CTCATTAGAAAGGTCTGGGAAGG + Intergenic
1077645499 11:3919950-3919972 CTGAGTAGAAAGGGCTAAAGGGG - Intronic
1078919108 11:15810462-15810484 ATAATTAGAAAAGACTAACAGGG + Intergenic
1079289773 11:19177287-19177309 CTGATTTGAAAGGTCTGAGATGG - Intergenic
1080244682 11:30166346-30166368 GTGTTTAGGCAGGTCTAACAAGG + Intergenic
1080494830 11:32806805-32806827 CTGATCTGATAGGTCTGACATGG + Intergenic
1082575996 11:54804078-54804100 ATGAAAAGAAAGGTTTAACACGG + Intergenic
1085071614 11:73551707-73551729 AAGATTAGAAAATTCTAACATGG + Intronic
1085151485 11:74255759-74255781 CTGATTCAATAGGTCTGACATGG - Intronic
1087221414 11:95550593-95550615 TTAATTTCAAAGGTCTAACATGG + Intergenic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1090532070 11:127601114-127601136 CTGCCTAGAAAGGTGGAACAAGG - Intergenic
1090994213 11:131850647-131850669 CTGATCAGAAGGGTCTAATGAGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1093163455 12:15777343-15777365 CTGATTAGAAAGGTCCACTGTGG - Intronic
1095409218 12:41903945-41903967 CTGATTACATAGGTCTAGGATGG - Intergenic
1103027402 12:117584562-117584584 CTGATTAGCAATGTCTGCCACGG + Intronic
1109619417 13:64881755-64881777 CTGACTTGAAAAGTCTAACTAGG - Intergenic
1112640931 13:101274220-101274242 CGGATAAGAAAGGTCTTAGAAGG + Intronic
1117815555 14:59593937-59593959 CTCATTAGGAAGGTCTAATTAGG - Intergenic
1126498167 15:49315732-49315754 CTGAATAGGAATGTCTAACGAGG - Intronic
1126900779 15:53312308-53312330 CTGATTAGAAAGATAGGACAAGG - Intergenic
1127469529 15:59277954-59277976 CTGTACAGAAAGGTCTAAAATGG - Intronic
1130090691 15:80818787-80818809 TTGATTAATAATGTCTAACATGG + Intronic
1130367004 15:83249707-83249729 CTGATTAAGAAGGTCTGAGATGG - Intergenic
1131156451 15:90078910-90078932 CTCATTATAAAGCTCTTACAGGG - Intronic
1141135381 16:81461435-81461457 TTGATTAGCAATGTCTACCACGG - Intronic
1141146724 16:81536136-81536158 CTGATTTCAAAGGTTTTACAGGG - Intronic
1141389155 16:83649867-83649889 CTGGTTAGAAAGGTACAACCTGG - Intronic
1141849128 16:86632170-86632192 CTGCATAGAAAGGGCTGACATGG - Intergenic
1141867300 16:86759527-86759549 CTTATTGGAAAGCTCTAAAATGG - Intergenic
1148927729 17:51102079-51102101 CTGATTAGAAAGGTCTAACATGG + Intronic
1149635693 17:58167490-58167512 CTGATTAGAAAGGTATAGGGAGG + Intergenic
1157509081 18:48255035-48255057 CTTATAAGCAAGGTCCAACAGGG + Intronic
1157654020 18:49367418-49367440 CTGAATAGAATGAACTAACAGGG - Intronic
1158851697 18:61501140-61501162 CTGATTGGGAAGCTCTCACAGGG + Intronic
1159992848 18:74930385-74930407 CTGATTAAAAAGGTAAAACCAGG - Intronic
1160000911 18:75021131-75021153 CTGATTTCAAAGCTCTAAAAAGG + Intronic
1168572254 19:57481171-57481193 CTGATGAGAAATGACTCACAAGG - Intergenic
927726303 2:25426123-25426145 CTGATTAGAATGGTTTAATTAGG + Intronic
930069205 2:47352333-47352355 GTGATTAGAAAGGTCCTAAAAGG + Intronic
939395351 2:141622449-141622471 CTGATGTGCAAGTTCTAACAAGG - Intronic
945097990 2:206237827-206237849 CTGGTCATAAAGATCTAACAGGG + Intergenic
946795175 2:223343531-223343553 CAGATTTGAAAGGACTAAAAAGG - Intergenic
947390596 2:229635394-229635416 TTGATTAGCAATGTCTACCAAGG + Intronic
948684490 2:239661674-239661696 CTGATTAGAAAGAACAAACAAGG - Intergenic
1170073775 20:12397119-12397141 CTGTTTAGAAAGTTCTAGAAAGG - Intergenic
1174942368 20:54943173-54943195 CTGAGAAGAAAAGTATAACAGGG + Intergenic
1178051454 21:28752392-28752414 TTGATTAGAAACGTCTTAGAAGG - Intergenic
1184626131 22:45731807-45731829 ATGATTAGTAAGATCTAACATGG - Intronic
951895583 3:27606718-27606740 TTGATTAGTAATGTCTGACATGG + Intergenic
953373472 3:42408926-42408948 CTGTTGAGAAATGTCTAACTTGG + Intronic
955333485 3:58066529-58066551 CTTGTTAGAAAGGTCGAAGAAGG - Intronic
957810032 3:85210036-85210058 CAGATAAGAAAAGTCTAGCACGG + Intronic
959253347 3:103976262-103976284 CTTATTAGAAATGGCAAACAAGG + Intergenic
960701566 3:120444414-120444436 TTGATTAGAAATGTCTGTCATGG + Intronic
962664865 3:137643797-137643819 CTGATTATTCAGGTCTAAAAGGG - Intergenic
964123976 3:153216893-153216915 CTGATTAGACAGGTCTAGGTAGG + Intergenic
966092207 3:176153587-176153609 CTGATTATCAAGGTGAAACAAGG + Intergenic
966441029 3:179944496-179944518 ATGCCTGGAAAGGTCTAACATGG + Intronic
970781728 4:19745722-19745744 CTGAGCAGAAAGGTAAAACAAGG + Intergenic
971666789 4:29497310-29497332 CTGATAAGAAAGGTATTACATGG + Intergenic
972149333 4:36068999-36069021 CTGCTTAGATATGTCTAGCAAGG + Intronic
975694995 4:77003657-77003679 CTGATTAGAAAAGCCTTATATGG - Intronic
976351485 4:84065017-84065039 CTCAGAAGAAAGGTCTGACATGG + Intergenic
976398854 4:84585430-84585452 CTGATAAGAAAGGACAGACAGGG - Intronic
978334912 4:107656521-107656543 CTCATTAGAAAGCTCAAGCATGG + Intronic
979132406 4:117063955-117063977 GTGATTAGATAGGTCTAGCTTGG - Intergenic
979544979 4:121930115-121930137 CAGATAAGAAAGGAATAACAAGG + Intronic
982944016 4:161595339-161595361 AAGATTATAAAGGTGTAACAGGG - Intronic
984475712 4:180231699-180231721 CTAATTATTAATGTCTAACAAGG + Intergenic
987187058 5:15432914-15432936 CAGAGTAGAAAGGTCCTACAAGG + Intergenic
987727643 5:21722845-21722867 CAGAGGAGAAAGGACTAACAAGG - Intergenic
987742948 5:21933878-21933900 CTGATTACAAAAGTTTCACAGGG - Intronic
988656952 5:33222431-33222453 CTGTTTTGAATGGTCTAAAAGGG + Intergenic
993335587 5:86654156-86654178 TTTATTAGGAGGGTCTAACATGG - Intergenic
995072756 5:107943239-107943261 CTGAATGGAAAGGGCTCACAGGG - Intronic
995094878 5:108224337-108224359 CTGATTCAAATGATCTAACAGGG - Intronic
995099219 5:108278455-108278477 CTGAGAAGAAAAGTGTAACATGG + Intronic
995492665 5:112708704-112708726 CTATTTAGAAAGGACTAAAATGG + Intronic
996757574 5:126950686-126950708 CTGTTGAGAATGGTCTAATAAGG - Intronic
998027302 5:138829483-138829505 CTGATTAGGAGGCTCTAAAACGG - Intronic
1000025976 5:157359536-157359558 CTGATTAGAGATGTCTGCCATGG - Intronic
1000233559 5:159336953-159336975 CTGATTAGAAAAGTAATACAAGG - Intergenic
1000842016 5:166231738-166231760 CTGAATAGAAAGGGATAAAAAGG - Intergenic
1004815358 6:19306569-19306591 CTGATCAGAAAGGTCTTGCTGGG - Intergenic
1005897269 6:30189003-30189025 CTGATTAGAAAGTGCAAAGAGGG + Intronic
1006534222 6:34684948-34684970 CTTCTTAGAAACCTCTAACAGGG - Intronic
1008348633 6:50460926-50460948 CTTATAAGAAAGGTTTAACTAGG - Intergenic
1008604703 6:53129150-53129172 CTGGTTAGCAAGCTTTAACATGG - Intronic
1010844020 6:80682355-80682377 TTTATTAGAAAAGACTAACAAGG - Intergenic
1010880713 6:81166845-81166867 CTGATTAGAAAGGTAACACTGGG - Intergenic
1012230811 6:96759244-96759266 CTAATAAGAAAGTTCTAAAATGG + Intergenic
1013742282 6:113301316-113301338 CTGTTTTTAAAGGACTAACAGGG - Intergenic
1014002324 6:116378268-116378290 CTGTTTAGAAAGGTTTAAATGGG + Intronic
1014039174 6:116804581-116804603 CAGATTAGAAAGGAAGAACAGGG - Intronic
1015406277 6:132840554-132840576 ATGATTAGAAAGGTCAAAAAGGG - Intergenic
1015782558 6:136884224-136884246 CTGATTGGAAAGGTCAGAAAAGG + Intronic
1015975940 6:138790761-138790783 CTGATTAGCAATGTCTGCCATGG - Intronic
1020039131 7:4987930-4987952 CTGATAAGGAAAATCTAACAGGG + Intronic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1023946237 7:44805236-44805258 CTGGTCAGAAAGGTCTCAAATGG + Intronic
1025583254 7:62746864-62746886 ATGAAAAGAAAGGTTTAACAGGG - Intergenic
1030476240 7:110036291-110036313 ATGGTTAGAAAGGGCTAAAAGGG - Intergenic
1030788571 7:113694757-113694779 CTGATTTTAAAGGGCTAAAACGG - Intergenic
1031338736 7:120571918-120571940 CTGATTAGAATGGTAAAACTAGG + Intronic
1032298035 7:130660305-130660327 CTGATTAGAAGGGTGGAAAATGG - Intronic
1035234269 7:157486130-157486152 CTGATTACAATGGTTTAATAGGG - Intergenic
1036696372 8:10977660-10977682 CTGCCTCGAAAGGTCTATCACGG + Intronic
1037563619 8:20097441-20097463 CTGATTTGAAAGTTAAAACAGGG - Intergenic
1038153654 8:24966136-24966158 CTGATTCAAAAGGACTAAAAAGG + Intergenic
1047189589 8:122666024-122666046 CTTATTAGAAATGTCCAAAATGG + Intergenic
1047654726 8:126964705-126964727 AAGGTTACAAAGGTCTAACAGGG - Intergenic
1049474406 8:142790119-142790141 CTGCTTAGACAGCTCCAACAAGG - Intergenic
1051071127 9:13168842-13168864 TTGAATAGAAAGGTCTCTCAGGG + Intronic
1052411831 9:28131188-28131210 GTGATTAGTGATGTCTAACAAGG + Intronic
1052684329 9:31735193-31735215 CTTAGTACAAAGATCTAACAAGG + Intergenic
1058613596 9:106801671-106801693 TTCATTAGAAAGGTACAACATGG - Intergenic
1058772756 9:108253271-108253293 GTGATTAGAAAGGTAGAAAATGG + Intergenic
1059226611 9:112678770-112678792 CTGAACAGAAAGGTCCAAGAAGG + Intergenic
1059609095 9:115872549-115872571 TTTATTATAAAGGGCTAACATGG + Intergenic
1188412068 X:29885136-29885158 GTGAGTACAAAGGTCTAAGAAGG - Intronic
1189032154 X:37461641-37461663 CTGATGAGAAAGGTCACAGATGG - Intronic
1194978056 X:100412303-100412325 CTAATTAAAAAGGCCTAAAAAGG + Intergenic
1196116443 X:112004590-112004612 CTGATTTAGAAGGTCTAATATGG - Intronic
1198485541 X:137083887-137083909 CTGATTAGAGTGATGTAACATGG - Intergenic
1199423419 X:147673972-147673994 GTGATTAGAAGGGTCTCTCAGGG + Intergenic
1199458509 X:148056641-148056663 CTGATTAGGAAGCTCAACCAAGG + Intergenic
1199794909 X:151184651-151184673 TTGATTAGAAAGGGGCAACAGGG - Intergenic