ID: 1148929955

View in Genome Browser
Species Human (GRCh38)
Location 17:51120294-51120316
Sequence CTCCGGGGGCGGCCGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 723}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148929955_1148929963 -10 Left 1148929955 17:51120294-51120316 CCCCGCCCCGGCCGCCCCCGGAG 0: 1
1: 0
2: 6
3: 95
4: 723
Right 1148929963 17:51120307-51120329 GCCCCCGGAGACGGATCCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1148929955_1148929970 8 Left 1148929955 17:51120294-51120316 CCCCGCCCCGGCCGCCCCCGGAG 0: 1
1: 0
2: 6
3: 95
4: 723
Right 1148929970 17:51120325-51120347 CGCGGCCCCCGCCCTGCCGCCGG 0: 1
1: 1
2: 1
3: 53
4: 493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148929955 Original CRISPR CTCCGGGGGCGGCCGGGGCG GGG (reversed) Intronic
900119943 1:1044279-1044301 CTCGGCGGGCGGCGGGGACGGGG + Intronic
900137916 1:1126263-1126285 CTCCCGGGGCGGCACCGGCGTGG + Intergenic
900176305 1:1292929-1292951 CTCCGGAGGAGGCCGGGATGCGG + Exonic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
900648150 1:3718208-3718230 CCCCGGGGCGGGGCGGGGCGGGG + Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
901045521 1:6393493-6393515 CTCGGGGTGGGGCCGGCGCGGGG - Intronic
901050721 1:6424706-6424728 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
901433858 1:9234666-9234688 CGCTGGCGGCCGCCGGGGCGGGG - Intergenic
901551304 1:9997698-9997720 CTCGGGGTCCGGCCGGGGAGGGG + Intronic
901641253 1:10694232-10694254 CTCGGGCGGCGACCCGGGCGCGG - Intronic
901648551 1:10729382-10729404 CTCATGGGGTGGCCGGGGAGAGG - Intronic
901673036 1:10867095-10867117 CTGCGGGGGCGGCGGGGGTTGGG - Intergenic
902304733 1:15527102-15527124 CTCGGAGGGCGGCGGGGGAGGGG + Intronic
902311516 1:15584928-15584950 GTCCGGGTGCGCCCGGGGCCCGG - Exonic
902394544 1:16125395-16125417 CTCGGTGGGCGGCTGGGGAGGGG + Intronic
902448802 1:16484150-16484172 CTCCGGGTAGGGGCGGGGCGGGG - Intergenic
902823298 1:18956399-18956421 CTCCCGGCGCGGCCGGGCCAGGG + Exonic
903232598 1:21931184-21931206 CTGCTGGGGTGGCCGGGTCGGGG - Intronic
903233865 1:21937340-21937362 CTGCGGGGGCGGGGCGGGCGGGG - Intergenic
903349921 1:22711209-22711231 CCCCGCGGGCGCCCGGGGAGCGG + Intronic
903350014 1:22711490-22711512 CACCGCGGCCGGCCGGGGTGGGG + Intronic
903738250 1:25543843-25543865 CTCCGCGGGCGCCCGGAGTGCGG + Intronic
903883721 1:26529631-26529653 CTCGGGGCGCGGCGGGGGCGGGG + Intergenic
903886092 1:26541998-26542020 CTCTGGTGGCGGGCGGGGGGAGG - Intronic
904006595 1:27366328-27366350 CTGCGGGGGCGGCCGCGGCCGGG + Exonic
904045162 1:27604224-27604246 CGCGCGGAGCGGCCGGGGCGGGG - Intronic
904190056 1:28736688-28736710 ATCCTGGGGCGGTGGGGGCGGGG + Intronic
904252990 1:29237838-29237860 CTCCTGCGGTGGCCGGGCCGCGG + Intronic
905449008 1:38045439-38045461 CGGCGGGGGCGGTGGGGGCGCGG + Exonic
905647198 1:39633019-39633041 CCCCGGGGGCGGGGCGGGCGAGG + Intronic
905734567 1:40316651-40316673 CGCCGGGGGCTGCGGGCGCGCGG - Intronic
905734803 1:40317447-40317469 CTCGAGGGGCGACCGGGGTGCGG + Intronic
905847056 1:41242059-41242081 CTGAGGGCGCGGCGGGGGCGCGG + Intronic
905889528 1:41510709-41510731 TCCCTGGGGCGGCCGGGGCAAGG + Exonic
906205100 1:43982386-43982408 CTCTGTGGTCGGCGGGGGCGGGG - Intronic
907237465 1:53062117-53062139 CTCCCGGGGCGGGTGGGGAGTGG + Intronic
907261213 1:53220244-53220266 CTGAAGGTGCGGCCGGGGCGGGG - Exonic
908014168 1:59814731-59814753 CCGGGGGGGCGGGCGGGGCGGGG - Intergenic
908462348 1:64357594-64357616 CCCTGGGGGCGGCGGGGGTGGGG - Intergenic
908544361 1:65148741-65148763 CTCCAGGGGCGGCCGGTGGGAGG + Intronic
910759286 1:90718853-90718875 CGCGGGGCGCGGCAGGGGCGCGG - Intergenic
911052367 1:93681688-93681710 CTCCGGGAGCAGCCGCGGCGCGG - Intronic
912246322 1:107965070-107965092 CTGCAGCGGCGGCCGGGTCGCGG - Exonic
912381317 1:109249652-109249674 CGTCGGGGGCCGCCGGGGCCGGG + Intergenic
913996025 1:143652451-143652473 CTCAGAGGGGAGCCGGGGCGAGG - Intergenic
914753037 1:150548944-150548966 CTCCAGGGGCGCCTGGAGCGAGG - Intergenic
915070334 1:153261126-153261148 CTCTGGCGGCGGCTGCGGCGGGG + Exonic
915070344 1:153261150-153261172 CTCCTCCGGCGGCGGGGGCGGGG + Exonic
915463191 1:156081738-156081760 CGCCGCGGGCGGCGGCGGCGGGG + Exonic
915519906 1:156436123-156436145 CTCCGGCCGCGGGCGCGGCGGGG + Intergenic
915935757 1:160089445-160089467 CTCCTGGGGAGGTCGGGGGGAGG + Exonic
916179283 1:162070018-162070040 CTCCGGGTCCGGCCGCCGCGCGG + Exonic
916792604 1:168136975-168136997 CTCCGGGGGCCGGAGGGGCCCGG - Intronic
919463243 1:197902939-197902961 AGCCCGGGGCGGCCGCGGCGGGG - Intronic
919822177 1:201480537-201480559 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
920541842 1:206784660-206784682 CCCCGGGGGCGGCGGGGGTGTGG + Intergenic
921175273 1:212587939-212587961 CTGCTGGGGCGGCGGGGGTGGGG + Intronic
921866652 1:220094094-220094116 CTCCGGGAGCGGAAGGGGCGGGG - Exonic
922372993 1:224929876-224929898 CTCGGCGGGCGGGCGGCGCGTGG + Intronic
922502884 1:226110047-226110069 CTCCGGGGAGCGCGGGGGCGGGG + Intergenic
922722053 1:227904267-227904289 CTCTGGGTGCAGACGGGGCGGGG + Intergenic
922739437 1:228007056-228007078 CGCCGGGGGGGGCCGGGCCCTGG - Exonic
922744929 1:228038287-228038309 CTCCGGCGGGGACCGGGGCGCGG + Intronic
922917537 1:229271044-229271066 CGCACGGGGAGGCCGGGGCGGGG - Intronic
922925152 1:229342208-229342230 CTCTACGGGCGGCGGGGGCGAGG + Exonic
922937189 1:229431942-229431964 CGCCGGGGGCCGGCGGGGCCTGG + Intronic
924172418 1:241356680-241356702 CTCCGGCGGCCGCCGCGGCGCGG - Intronic
924436802 1:244049230-244049252 CTGCGGGGTCGGGCGGGGTGCGG + Intronic
924732523 1:246724637-246724659 CTGCGCGGGCGGCTGGGCCGGGG + Intronic
1062774549 10:135031-135053 CTCCGAGGGCGGGCGGGCCGAGG + Intronic
1063565875 10:7171982-7172004 CTCTGGGGGTGGCCGGCGCACGG + Exonic
1064208810 10:13347323-13347345 CGTCGGAGGCGGCCGGGGAGGGG + Intronic
1065099517 10:22320604-22320626 GCCCGCGGGCGGCCGAGGCGGGG - Intronic
1065099568 10:22320740-22320762 CCGCGGGGCCGGCCGGGGGGCGG + Intronic
1065390079 10:25174576-25174598 GCCCGCGGGCGGCGGGGGCGCGG - Intergenic
1067060746 10:43076908-43076930 CGCGGGGTGCGGCCGGGGCGCGG - Intergenic
1067669686 10:48307208-48307230 CCCCGGAGGCAGCCAGGGCGCGG - Intronic
1067769812 10:49115310-49115332 CTCCGGGCGCGGGCGGGGGGCGG - Intronic
1068866801 10:61903256-61903278 CTCCCGGGGAGGGCGGGGAGGGG + Intronic
1068910550 10:62374508-62374530 CTGCCGGGGTGGCCGGGGCTGGG + Intronic
1069818304 10:71212500-71212522 GACCGCGCGCGGCCGGGGCGGGG - Intergenic
1070032615 10:72692193-72692215 CTCTCGGGGCGGCGGCGGCGGGG + Exonic
1070162237 10:73873723-73873745 CTGGGGGGGCGGGCGGGGCGGGG + Intronic
1070333008 10:75431425-75431447 ATCCGGGGGAGGGAGGGGCGCGG + Intergenic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1070923855 10:80205401-80205423 CTCCGCGGGCGTCCCGGGCGCGG + Exonic
1072294172 10:93993815-93993837 CACCGCGGGCGGCCGGGCGGGGG - Intergenic
1072784011 10:98268281-98268303 CTCCAGGCCCGCCCGGGGCGGGG - Intergenic
1073058254 10:100715694-100715716 CGCCGGCGGCGGCTGGGGCGGGG - Intergenic
1073076691 10:100828922-100828944 CTACGGGGCCGGGCGGGGCGGGG - Exonic
1073214700 10:101829811-101829833 CTCCTGGTGGGGGCGGGGCGGGG - Intronic
1073452072 10:103616016-103616038 CTCCGGGGTGGGGCGGGGTGGGG + Intronic
1074591922 10:114821869-114821891 CTCCGGAGGGCGCCGGGACGCGG - Exonic
1075438509 10:122461808-122461830 CTGCGAGGGCGGCCGGGCCCGGG + Exonic
1075645465 10:124093337-124093359 CGCCGGCGGCGGCCGGGGCTGGG - Intronic
1076116961 10:127907443-127907465 CCGCGGGGGCGGCGGGGCCGGGG - Intronic
1076554277 10:131311789-131311811 GTCCGGGGGCGGCGGCGGCGCGG - Intergenic
1076664502 10:132078610-132078632 CTCTGGGGGCGGGGGGGGGGGGG + Intergenic
1076722211 10:132397573-132397595 GGCCGGGGCGGGCCGGGGCGGGG + Intronic
1076868824 10:133182812-133182834 CTGCGCGGGCGGCGAGGGCGCGG + Intronic
1076878682 10:133229848-133229870 GGGCGGGGGCGGCGGGGGCGGGG + Intergenic
1076900911 10:133336919-133336941 CTTCGCGGCCGGGCGGGGCGGGG + Intronic
1077048283 11:555606-555628 ACCAGGGGGCGGCCGGGGCGGGG + Intronic
1077076989 11:706410-706432 CTTGGAGGGCGGCCGGGCCGAGG + Intronic
1077085590 11:748258-748280 CTCCGTGGGCGGCAGGTGCCCGG + Intronic
1077182970 11:1224605-1224627 CTGCGGCGGGAGCCGGGGCGTGG + Intronic
1077250151 11:1557298-1557320 CGCCGGGGGCGTGGGGGGCGCGG + Exonic
1077614943 11:3667763-3667785 CTCTGGGGGCAGGCGGGGCAGGG + Exonic
1077886275 11:6390362-6390384 CTGCGGAGGCGGAGGGGGCGGGG - Intergenic
1077898826 11:6474014-6474036 CCGCGGCGGCGGGCGGGGCGTGG - Intronic
1078057396 11:8019212-8019234 CTGCGGGCCCGGCCGAGGCGCGG - Intergenic
1078066234 11:8081152-8081174 CTGCGGGGCGGGGCGGGGCGGGG + Intronic
1078156806 11:8806816-8806838 CTCCTGGGGAGGCAGGGGCTGGG - Intronic
1078190851 11:9091635-9091657 CTCGGGGGGCGGGCGGGGCCGGG - Intronic
1079630363 11:22666994-22667016 CACCCGGGGCGGCGGGGGAGGGG + Intronic
1080258725 11:30322992-30323014 CTCCGGGGACGGAAGGGGCGGGG - Intergenic
1080606548 11:33869310-33869332 CACCGGGGGTGGCAGGGGCAGGG + Intronic
1081804960 11:45885556-45885578 CTCCGGGGGCGGGGCTGGCGGGG + Intergenic
1081807900 11:45900158-45900180 CTCTGCGGGCGGCGGCGGCGCGG + Exonic
1082002392 11:47400297-47400319 CCCTGGGGGCGGGCGGCGCGGGG - Intergenic
1083258109 11:61508866-61508888 CGCGGGGGAAGGCCGGGGCGGGG + Exonic
1083258140 11:61508927-61508949 GCTGGGGGGCGGCCGGGGCGGGG + Exonic
1083448487 11:62726937-62726959 GTCGGGCGGCGGCCCGGGCGGGG - Exonic
1083753871 11:64778575-64778597 GGCCGGGGGCGGCGGGGCCGGGG + Intronic
1083945043 11:65918999-65919021 CGGCGGCGGCGGCCGTGGCGGGG - Exonic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1084102458 11:66958571-66958593 CGCCGGGGACGGGAGGGGCGGGG - Intergenic
1084284106 11:68120763-68120785 CGCGGGGCGGGGCCGGGGCGGGG - Intronic
1084385709 11:68841695-68841717 GGCCGGGGACGGGCGGGGCGCGG - Intronic
1084387717 11:68854718-68854740 CGCCGGGGCCGGCAGGGGAGGGG - Intergenic
1084814818 11:71639791-71639813 GTCCGGGGGTGCCGGGGGCGCGG + Intergenic
1084946690 11:72642484-72642506 GGCCGGGGGCGGGCGGGGGGCGG - Intronic
1084973025 11:72781679-72781701 CGCCGGGGCCCGCCGGGGCCGGG + Intronic
1084973107 11:72781913-72781935 CTGCGGGGTGGGGCGGGGCGGGG - Intronic
1086050335 11:82581637-82581659 CACCGGGGCCTGCCGGGGGGTGG + Intergenic
1086337156 11:85811249-85811271 GGCCGGGGCGGGCCGGGGCGGGG - Intergenic
1087505907 11:99020836-99020858 CAGCGCGGGCGGCCGGGGAGGGG + Intergenic
1088223228 11:107591224-107591246 CTGCGGGCGCGGAAGGGGCGGGG - Exonic
1089243060 11:117098244-117098266 GTCCGCGGGAGGCCGGGGCTGGG + Exonic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1090780387 11:130002210-130002232 CTCCGGCGGCGGCGGTTGCGCGG - Intronic
1090832354 11:130428259-130428281 ACCGGGGGGCGGCGGGGGCGGGG + Exonic
1091218704 11:133918577-133918599 CTCCGGGGCCGGCCGAGGAAGGG - Intronic
1091273086 11:134331827-134331849 GTCGGGGGGGGGGCGGGGCGGGG - Intergenic
1091286755 11:134412280-134412302 CTCGGGGCGGGGGCGGGGCGGGG - Intergenic
1091434047 12:459977-459999 GTCCGGGGCTGGCGGGGGCGCGG + Intergenic
1091740930 12:2959832-2959854 CACCGGGGCCGGTCGGCGCGGGG + Intronic
1091857728 12:3752965-3752987 CGGCCGGGGCGGCCGGGGGGCGG - Intronic
1091888119 12:4031403-4031425 CTCCGGGCGCGGCCGGCGATTGG - Intergenic
1092254324 12:6917882-6917904 CTCCTGGGGCGGGCAGGGAGGGG + Intronic
1092743251 12:11649918-11649940 CGCGCGGGGCGGCGGGGGCGTGG - Exonic
1092784042 12:12011738-12011760 TTCATGGGGCGGCCGGGGCGGGG + Intergenic
1095301443 12:40589391-40589413 CTCTGGGGCGGGACGGGGCGGGG + Intergenic
1096116856 12:49060117-49060139 CCCGGGCGCCGGCCGGGGCGGGG - Intergenic
1096260139 12:50085295-50085317 CTCGGGGGGCGCTCGGGGGGCGG + Exonic
1096336969 12:50764168-50764190 CTCGGGGGTCAGGCGGGGCGGGG - Intronic
1096495436 12:52037120-52037142 CTCCCCCGGCGGGCGGGGCGGGG - Intronic
1096983629 12:55743154-55743176 GGCCGGGGGCGGCGGGCGCGCGG - Intergenic
1097264798 12:57738649-57738671 GTGCGGGGGAGGCAGGGGCGGGG + Intronic
1099202143 12:79690115-79690137 CTCCCGGGGGGGCCGGGCCCGGG + Exonic
1100399112 12:94212481-94212503 CACCGGGGCCTGCCGGGGGGTGG - Intronic
1102151018 12:110689175-110689197 GGGCGGGGGCGGCCCGGGCGGGG - Intronic
1103348359 12:120265778-120265800 CACAGGGGGCGGCCGGGGGCGGG - Intergenic
1103510090 12:121467742-121467764 GCCCGGGGGCGCCCGGGCCGTGG + Intronic
1103749704 12:123150629-123150651 CTCGGCGGGCGGGCGGGCCGGGG + Intergenic
1103779434 12:123389205-123389227 CGCGGGGGGCGGGCGGCGCGCGG + Intronic
1105409642 13:20161094-20161116 GTTCGGAGGCGGCGGGGGCGTGG - Intergenic
1106247284 13:27960993-27961015 CTGTGGGCGCGGCCGGGGCGCGG + Intergenic
1106250495 13:27978554-27978576 CTTTGGGGCCGGGCGGGGCGGGG - Intronic
1106308270 13:28532416-28532438 CTCCGCGGGCGCTCGGGGCTGGG - Intergenic
1107467938 13:40666267-40666289 CACTGGGGGCGGACGGGGAGGGG + Exonic
1107838815 13:44435235-44435257 CTCCGGGCGAGCGCGGGGCGGGG - Intronic
1108572822 13:51767772-51767794 CTCCTGGGGCGGGGGGGGGGGGG + Intergenic
1112580636 13:100674386-100674408 CGCCGGGTGCGCCCGGGCCGAGG + Intronic
1112621911 13:101061910-101061932 CTGCGGGGCAGGGCGGGGCGGGG + Intronic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113517693 13:110915486-110915508 CGCCTGGGGCGGCCGGGGGCGGG + Intergenic
1113587835 13:111477285-111477307 CTCCTGGGGTGGCTGGGGTGGGG + Intergenic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1114563049 14:23607272-23607294 CTCAGGGGGTGGCAGGGGCCCGG - Intergenic
1115028235 14:28766825-28766847 GTCCCGGAGCGGCCGCGGCGAGG - Intergenic
1115851701 14:37594829-37594851 TGCCGGGGGAGGCCGGGGAGCGG - Intronic
1116018229 14:39432008-39432030 CTGCGGGGGCGGCCGGGAGCCGG - Exonic
1116817826 14:49599695-49599717 CTCCTGGGGAGGCCGGGACGGGG + Intronic
1116916666 14:50532328-50532350 GTTCGCGGGCGGCCGGGGAGGGG - Intronic
1117029277 14:51652052-51652074 CACAGCGGGCGTCCGGGGCGCGG - Intronic
1119326120 14:73760389-73760411 CTCAGGCGGCGGCCGGGGCTGGG + Intronic
1119623725 14:76152281-76152303 CTCAGGGACGGGCCGGGGCGTGG + Intronic
1120990181 14:90368597-90368619 CAGCGGGGGCGGGCGGGGTGGGG + Intergenic
1121011896 14:90524668-90524690 CTCCGGGGATGGACGGTGCGAGG - Exonic
1121458075 14:94051880-94051902 CTCCTGGGGCGGCAGGGAGGTGG - Intronic
1121484349 14:94303211-94303233 TTCCTGGGGCGGGGGGGGCGGGG - Intergenic
1121616982 14:95319908-95319930 CGGCGGGCGCGGGCGGGGCGCGG + Intergenic
1121711010 14:96039306-96039328 GCGCGGGGGCGGGCGGGGCGGGG - Exonic
1122194362 14:100073999-100074021 CCCCGGGGGCGGTGGGGGCGGGG + Intronic
1122359596 14:101151541-101151563 CGCCGGGTGAGGCCAGGGCGTGG + Intergenic
1122470798 14:101964700-101964722 GCCCGGGGGCGGCGGCGGCGAGG + Exonic
1122615112 14:103011868-103011890 CTCCTTGGGAGGCCGAGGCGGGG + Intronic
1122779693 14:104138489-104138511 CTCCCGGGGCGGGCGGCGAGGGG - Intergenic
1122904554 14:104795771-104795793 CTCCGGGCGCGGGGCGGGCGCGG - Intergenic
1122978628 14:105181320-105181342 CTCCGTGGGCGCGCGGGGCGGGG + Intronic
1123004456 14:105314692-105314714 GGCCGGGGGCGCGCGGGGCGCGG + Exonic
1123025029 14:105420253-105420275 CATCGGGGGCGGGCGGGGCTCGG + Intronic
1123039958 14:105486451-105486473 CTGCGGGGGCTGCGGGGGCTGGG - Intergenic
1123480693 15:20628746-20628768 CTCGGGCGGCGGCGGGGGCCGGG + Intergenic
1123637316 15:22371621-22371643 CTCGGGCGGCGGCGGGGGCCGGG - Intergenic
1123684355 15:22786691-22786713 CGGCGGCGGCGGCCGGGGAGGGG + Exonic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124453615 15:29821781-29821803 CACTGGGGGCGGCCGGGGAGGGG - Intronic
1124629027 15:31326801-31326823 CCCCGGGGGTGGGCGGGGCCGGG - Intergenic
1124712963 15:32030447-32030469 GCGCGGGGGCGGGCGGGGCGGGG + Intergenic
1125516613 15:40324318-40324340 CTTCGGGGGCGGCGGCGGCGGGG + Intergenic
1125834446 15:42737144-42737166 CGCCGCGGGCGGCCAGGGAGGGG + Intergenic
1125874732 15:43133908-43133930 CTCCTGGGGGGCGCGGGGCGCGG - Exonic
1129116413 15:73367761-73367783 CTGCTGGGGCGGCGGCGGCGAGG + Exonic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129162242 15:73753221-73753243 GGCCGGGGGCGGCCGGGGCGCGG - Intergenic
1129854042 15:78811547-78811569 GGCCGGGGCCGGCCGGGGCGGGG - Intronic
1130531129 15:84748535-84748557 CTCCGGGGGCGGAGCGGGGGCGG - Intergenic
1131438281 15:92439939-92439961 ATCCGGGGGAGGCGGGGGGGTGG + Intronic
1131605673 15:93900596-93900618 CTCCGGCTGCGTCCGGGGAGCGG + Intergenic
1132111437 15:99105009-99105031 CTGGGCGGGCGGCCTGGGCGAGG - Intronic
1132464781 16:72462-72484 CTCCGGGGGCGGGCGGGTTCCGG - Intronic
1132498834 16:275871-275893 GCCCGGGGGCGGCCGGGGGGCGG + Exonic
1132512904 16:352914-352936 CGCGGGGCGGGGCCGGGGCGTGG + Intergenic
1132560224 16:590124-590146 GCCCGGGCGCGGGCGGGGCGGGG + Intronic
1132570617 16:642377-642399 CTCCGGGCGCGGGGGGTGCGCGG + Intronic
1132594761 16:743659-743681 CTCCGGGTGGAGCTGGGGCGGGG + Intronic
1132641532 16:980666-980688 CCTCGGGGACGGCCGGGCCGAGG + Intronic
1132641881 16:981792-981814 CGGCGGCGGCGGCAGGGGCGAGG + Exonic
1132690262 16:1178899-1178921 CTCCGGGGCTGGCAAGGGCGCGG - Intronic
1132694355 16:1195303-1195325 CTCAGGGCGGGGCAGGGGCGGGG + Intronic
1132718804 16:1305988-1306010 CTCCGGGGCCTGCTGGGGCCAGG - Intergenic
1132834051 16:1943493-1943515 CGCGAGGGGCGGCAGGGGCGGGG - Intergenic
1132865637 16:2091482-2091504 CGCTGAGGGCGGCCAGGGCGCGG + Exonic
1132887783 16:2190032-2190054 CTCTGGTGGGGGCAGGGGCGGGG - Intronic
1132889427 16:2196596-2196618 CTCCCGGCGCGGAGGGGGCGGGG + Intergenic
1133036440 16:3036554-3036576 CCCCGGGAGCGGCCTGGGGGCGG - Intronic
1133188523 16:4116581-4116603 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
1133300205 16:4777865-4777887 GTCCTGGGGAGGCCGGGGCCAGG + Exonic
1133370056 16:5240127-5240149 GTCCGGGGGTGCCGGGGGCGCGG + Intergenic
1133744097 16:8674430-8674452 CTCCGGGGGCGGGGGAGACGGGG - Intergenic
1134070216 16:11255930-11255952 CGCGGGGGGCGGCCTGGGTGGGG + Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1134554640 16:15154807-15154829 CGCGCGGGGCGGACGGGGCGCGG + Intergenic
1135517712 16:23149320-23149342 ATGCGGCGGCGGCCGTGGCGGGG - Intergenic
1136460503 16:30407570-30407592 CTCCGGGGGCGGGGAGGGGGCGG - Exonic
1136779009 16:32885617-32885639 GCCGGGGGGCGGCCGGGCCGGGG + Intergenic
1136891609 16:33975901-33975923 GCCGGGGGGCGGCCGGGCCGGGG - Intergenic
1137019886 16:35414704-35414726 CCCCGTGGGTGGACGGGGCGGGG - Intergenic
1137618009 16:49858223-49858245 CGCCGGGGCCGGCCGGGCCGCGG + Intergenic
1138572427 16:57884347-57884369 CTCGGGGGGCGTCCGGGGCGCGG + Exonic
1138584509 16:57961145-57961167 CTCCTGGGGCAGCAGGGGAGAGG + Intronic
1140223031 16:73057984-73058006 GGCCGGGAGCGGCGGGGGCGGGG + Intronic
1140821839 16:78670074-78670096 TTCCGGGGGCGGCCGGGAACAGG - Intronic
1140927577 16:79599185-79599207 CGGCGGAGGCGGCGGGGGCGCGG - Exonic
1140927661 16:79599437-79599459 CTCCTTGGGCGGCAGCGGCGAGG - Exonic
1141075956 16:81006885-81006907 GCCCGCGGGCGGCGGGGGCGAGG - Exonic
1141684304 16:85561671-85561693 CTCCGGGGGCAGCTGGGGCCGGG - Intergenic
1142176321 16:88647052-88647074 CTCCGGGGGCTGCGGGGCCCAGG - Intronic
1142209888 16:88803984-88804006 GTCCGGGGGCGGCGGGCGGGCGG - Exonic
1142242058 16:88952044-88952066 CTCCTGGGGCTGCTGGGGCCGGG - Intronic
1142300887 16:89257249-89257271 CTCCGGGGACGGGCGGGCTGCGG + Intergenic
1142352692 16:89587239-89587261 CTGAGGGGGCGGGAGGGGCGGGG - Intronic
1142400442 16:89855709-89855731 CTCAGGGGCCGCCCGGGGCCTGG + Intronic
1203081420 16_KI270728v1_random:1147706-1147728 GCCGGGGGGCGGCCGGGCCGGGG + Intergenic
1142467359 17:143965-143987 CTCGGCGGGCGGACGGGCCGGGG + Intergenic
1142509416 17:385024-385046 CCCCGGTGTCGGGCGGGGCGGGG + Intronic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1142683222 17:1562309-1562331 GTGGAGGGGCGGCCGGGGCGTGG - Intronic
1142708452 17:1710436-1710458 CTCCGGGGGCGGCGGCCCCGCGG - Exonic
1142711141 17:1724746-1724768 CTCCGGGCGCGGCGGGGCAGAGG - Intronic
1143078783 17:4366372-4366394 CTCTGGGGGCGGCTGGAGCGGGG + Exonic
1143140522 17:4739659-4739681 CTCCGGCGGCGGGCGAGGAGGGG + Exonic
1143148318 17:4790376-4790398 ATACGGAGGCGGCCGCGGCGCGG - Exonic
1143582370 17:7834626-7834648 CTCCAGGGCGGGGCGGGGCGGGG + Intergenic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143914191 17:10276653-10276675 CTCCAGGGGAGGCAGGGGCGGGG + Intergenic
1144604623 17:16653681-16653703 TCCCGGCGGCGTCCGGGGCGTGG - Intronic
1144907770 17:18650347-18650369 CTCTGGGAGCGCCCCGGGCGGGG - Intronic
1145034838 17:19533800-19533822 CTGGGCGGGCGGCCGGGGCGGGG + Intronic
1145063139 17:19744787-19744809 CGGCGGGGGCGCGCGGGGCGCGG + Intronic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1147168698 17:38606042-38606064 CGCCCGGGGCGGCGGGGGCGGGG + Intergenic
1147179082 17:38673781-38673803 CTCCGGGTGCGGCCGGAGCCGGG + Exonic
1147179105 17:38673832-38673854 CCTCGGGGGCGGCCGGCGGGGGG + Exonic
1147183672 17:38702405-38702427 CTCCGGGGACGGGCGGGGCGGGG + Intergenic
1147184447 17:38705773-38705795 CCCCGGGGGCGGCGTGCGCGGGG + Intronic
1147719838 17:42532251-42532273 GTCCGGCGGCGGCGGGAGCGAGG - Intergenic
1147743073 17:42679614-42679636 CGGCGGGGGCAGCCGCGGCGGGG + Exonic
1147793235 17:43025789-43025811 CTCCGGGGGGGGGGGGGGGGGGG + Intronic
1147891489 17:43720640-43720662 CTCTGGCGGCAGCGGGGGCGCGG - Intergenic
1147971035 17:44219235-44219257 CTCCGCCAGCGGCCGGGGCTCGG + Intronic
1147989744 17:44325384-44325406 TGCCGCGCGCGGCCGGGGCGGGG - Intergenic
1148023522 17:44569052-44569074 CTCCGGGGGGGGGGGGGGGGGGG + Intergenic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148122763 17:45222285-45222307 GGCGGGGGGCGGCAGGGGCGCGG + Intronic
1148268239 17:46243605-46243627 CTCTGCGGGCGGCGGCGGCGCGG + Intergenic
1148323643 17:46771490-46771512 ACGCGGGGGCGGCGGGGGCGGGG + Intronic
1148561032 17:48606215-48606237 CTCCGAGAGCGGCCGGGATGCGG + Intergenic
1148786805 17:50149641-50149663 CTTGGGGGGCGGCCGGGCAGGGG + Exonic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1149616660 17:58006747-58006769 CTCCGGGGACGTCCAAGGCGAGG + Intronic
1149806228 17:59620168-59620190 CTCCAGGTGCGGCCGGGCCCGGG + Exonic
1150060555 17:62065288-62065310 CACCGGGGAGGGCCGGGGGGGGG + Intergenic
1150225565 17:63523015-63523037 CTACGGGGCGGGGCGGGGCGGGG - Intergenic
1150408026 17:64919319-64919341 CAGTGGGGGCGGCCGGGGCCGGG + Intronic
1150643527 17:66964815-66964837 CTCCGGGGGCGCCGGGGTTGGGG - Intergenic
1151629929 17:75303579-75303601 CACCGTGGGAGGCCGAGGCGGGG - Intergenic
1151660674 17:75516509-75516531 CTCCGGCGGTGGGCGGGGCGTGG + Exonic
1151662542 17:75526222-75526244 CACGGGCGGCGGCCGGAGCGCGG + Intronic
1151919362 17:77141498-77141520 CTCGAGGGGCGGCCGGCGCCCGG - Intronic
1151939023 17:77281358-77281380 CTCCGGGGAGGGGCGGGGCGGGG + Intronic
1152069870 17:78129118-78129140 TTGCGGGGGCGGCGGGGGGGGGG - Intronic
1152227106 17:79097613-79097635 CTCCGGGGGCTCTGGGGGCGGGG - Intronic
1152262267 17:79273565-79273587 CTCTGGGGGGGGCGGGGGCGGGG + Intronic
1152357329 17:79813504-79813526 CGGCGGGGGCGGCGGGCGCGGGG + Intergenic
1152426347 17:80220565-80220587 CGCCGGGGGCAGCCGACGCGGGG + Intronic
1152468370 17:80477755-80477777 CCCCGGGGCGGGGCGGGGCGGGG - Intronic
1152527715 17:80898697-80898719 GTGCGGGGGGAGCCGGGGCGGGG - Intronic
1152744269 17:82031854-82031876 CTCGGGGCGCAGCCGGGGCGGGG + Intronic
1152781544 17:82229225-82229247 GTCCGGGGGCGCCCGGGGCATGG + Intronic
1152834406 17:82519945-82519967 GGCCGGGGGCGGCGGGGCCGGGG + Exonic
1152870691 17:82751719-82751741 GGCCGGGGGCCGCCAGGGCGGGG - Intergenic
1152870905 17:82752481-82752503 CTGCGAGGGCTGCCGGTGCGCGG + Intronic
1153226930 18:2906789-2906811 CTCTGCGGGCGGCGGGGGCGAGG - Exonic
1153285388 18:3450973-3450995 GTAGGGGGGCGGCGGGGGCGGGG - Intronic
1153514479 18:5891334-5891356 CCCCGGGGGGCGCCGCGGCGGGG + Exonic
1154151396 18:11908928-11908950 CTCTGGGGGCTTCTGGGGCGCGG - Exonic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1154214739 18:12407895-12407917 CTCCGGGCGCGGCGTGGGCGGGG - Exonic
1154214870 18:12408307-12408329 GAGCGGGGGCGGCCGGGGCGGGG + Intronic
1155199285 18:23503370-23503392 CTCCAGCGCCGGGCGGGGCGTGG + Intergenic
1155257866 18:24014477-24014499 ACCCGGGAGGGGCCGGGGCGCGG + Intronic
1155954006 18:31942443-31942465 CTCCGGGGGCGGCTGGAGGAGGG - Intronic
1156448498 18:37253742-37253764 AACCGGGGGCGGCCGGGGCGCGG - Intronic
1157384091 18:47247582-47247604 CTGCGGGGGCTGCCCCGGCGGGG + Intronic
1157384124 18:47247702-47247724 CGCCGAGGGCGGCTGAGGCGGGG + Intronic
1157609680 18:48948797-48948819 CTGGGGGGCGGGCCGGGGCGGGG - Intronic
1157612816 18:48968988-48969010 CTCCAAGGGGGGCCGGGCCGGGG - Intergenic
1158435940 18:57435663-57435685 CGGCGGGGGCGGCCGGCGGGCGG - Exonic
1158551459 18:58439585-58439607 CTCCTGGGGAGGCTGGGGAGTGG + Intergenic
1159369993 18:67516946-67516968 GGCCGGCGGCGGGCGGGGCGGGG + Exonic
1160204631 18:76822689-76822711 CCCCGCCGGCGGCCGGTGCGGGG + Intronic
1160453381 18:78979903-78979925 CCCCGGGTGCGGCTGTGGCGGGG - Intergenic
1160597684 18:79988473-79988495 GCCCGGGGGCGGCGGGGGCCGGG - Exonic
1160631266 18:80247591-80247613 CTCGGGGGCGGGGCGGGGCGCGG - Intergenic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160766819 19:812539-812561 GGCCGGGGGCGGGCGGGGGGCGG - Exonic
1160810801 19:1012219-1012241 CCCAGGGGGTGGCCTGGGCGGGG - Intronic
1160824142 19:1071559-1071581 CTCCGCGCGCGGCCGGCGCACGG - Intronic
1160855141 19:1213867-1213889 AGCCGTGGGAGGCCGGGGCGAGG + Intronic
1160864100 19:1249593-1249615 CTGCGGGCGCGGGCGGGGCGGGG + Intronic
1160864307 19:1250303-1250325 CTCCGGGCGCCGCCGGGCTGCGG - Exonic
1160904987 19:1447755-1447777 CTCTGGGGGTGGCCAGGGCCTGG - Intronic
1160914692 19:1491012-1491034 CGCCGGGAGAGGGCGGGGCGCGG - Exonic
1160930555 19:1567906-1567928 TTCGGGCGGCGGCCGGGGCGCGG + Exonic
1160930754 19:1568434-1568456 CGCGGGGCGGGGCCGGGGCGGGG + Intergenic
1161063599 19:2227154-2227176 CTCCGGCGGGGGCCGGGGCGGGG - Intronic
1161150104 19:2702870-2702892 CTCCGGGCGCGGGCGGGGCCGGG + Intergenic
1161153596 19:2721451-2721473 CCCCGGGGCGGGGCGGGGCGGGG - Intronic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161314931 19:3613317-3613339 CTCCGAGGAGGGCCCGGGCGGGG + Exonic
1161343299 19:3754172-3754194 GTGAGGGGGCGGCCGGGGCCGGG - Intronic
1161350084 19:3786425-3786447 CGCCGGGGGCCGCGGAGGCGGGG - Intronic
1161612487 19:5250935-5250957 GTGCGGGGGCGGCGGGGGGGGGG + Intronic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1161925042 19:7293864-7293886 CACCGGGGGCCGGCGGGGGGCGG - Exonic
1161976800 19:7611827-7611849 CTCCGGGGGTGGCTGGGTGGGGG - Exonic
1162059331 19:8085453-8085475 CTGTGGGGGTGGCCGGGGCTGGG - Exonic
1162125662 19:8498422-8498444 CCCCGGGGGCAGCGGGGGCTTGG + Exonic
1162128481 19:8511737-8511759 GTCCGGTGGGGGCAGGGGCGGGG + Exonic
1162935336 19:13979011-13979033 CTCCGGCGGCGGCGTGGGCCGGG + Intronic
1163453044 19:17390529-17390551 CTCCGGGGGCTGCCGGCGGCCGG - Intergenic
1163551178 19:17967169-17967191 GCCCGGGGGCGGCGGGGCCGGGG - Intronic
1163577163 19:18117791-18117813 GACCGCGGGCGGCGGGGGCGGGG - Intronic
1163786436 19:19277238-19277260 CCCCCGGGGCGGGCGGGGGGGGG + Intronic
1164155749 19:22596046-22596068 CTCCGGGAGCGGGCGGGGGCGGG - Intergenic
1164217171 19:23160773-23160795 CTCCCGGGGCAGCCGGGCAGAGG + Intergenic
1164492445 19:28727497-28727519 CTCGGGGGGCGCCCGGGCCGGGG - Intergenic
1164835121 19:31350900-31350922 CTCCGGGCGCTGCCGGGCGGCGG + Intergenic
1165049857 19:33134553-33134575 CTGCAGGGGCGGCAGGGGCTGGG + Intronic
1165433394 19:35784618-35784640 GTCTGGGTGGGGCCGGGGCGGGG - Intronic
1165944908 19:39436128-39436150 CTCTGTGGGCGGAAGGGGCGGGG + Intergenic
1166105699 19:40597137-40597159 CTCGGGCGGGGGCGGGGGCGGGG + Intronic
1166294613 19:41883011-41883033 GCTCGGGCGCGGCCGGGGCGGGG + Intergenic
1166361324 19:42254037-42254059 GCCCGGGGGCGGCGGGGGAGGGG + Intronic
1166677480 19:44748628-44748650 CCCCGGGGGGGCCGGGGGCGGGG + Exonic
1166802949 19:45469309-45469331 CTCCCGGGACGTCAGGGGCGGGG - Intronic
1166809453 19:45506935-45506957 TTCCCGGGGCGGGCGGGGTGGGG + Intronic
1166838448 19:45681830-45681852 CTCCGGCTCCGGCCCGGGCGAGG + Exonic
1166852846 19:45768686-45768708 CGGCGGCGGCGGCCGGGGCCGGG - Exonic
1167072984 19:47231247-47231269 CGCCGGGCGGGGGCGGGGCGGGG - Intronic
1167192351 19:48000202-48000224 TTTGGGGGGCGGCCGGGGTGGGG - Intronic
1167428439 19:49441476-49441498 CTGCGGGGCCGGCCGGGCCGGGG - Exonic
1167461608 19:49627557-49627579 CACTGTGGGAGGCCGGGGCGGGG + Intergenic
1167557062 19:50203349-50203371 CGCGGGGGGCGGCCGGGGGCGGG - Intronic
1167674317 19:50875000-50875022 CTCCGGGTGCGACCTGGGCCAGG - Intronic
1167738684 19:51311714-51311736 CCCGGGGGGCGGCGGGGGCGGGG - Intergenic
1168144899 19:54415482-54415504 CTCCGGAGTCGAGCGGGGCGCGG - Intronic
1168154526 19:54465353-54465375 CGCGGGGGGCGCCCGGGGCTCGG + Exonic
1168293016 19:55366142-55366164 GTCCGGGGGTGGCTGGGGCAGGG + Exonic
1168307221 19:55442326-55442348 TGCCGGGGGCCGCGGGGGCGAGG - Exonic
925068601 2:950070-950092 CTCCTGGGGCGCACGGGGCTGGG - Intergenic
926090115 2:10043941-10043963 CGCCCGGGTCGGCGGGGGCGAGG + Intronic
926801780 2:16665742-16665764 CTGGGGGCGCGGCAGGGGCGCGG - Intronic
927181096 2:20447281-20447303 CGGCGGGGGCGGTGGGGGCGCGG - Exonic
927619216 2:24634710-24634732 CTCCGGGGGCGGGGGGGGGGGGG - Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927881586 2:26693218-26693240 GTCCGGGGCCGGCTGGGGCTGGG + Intronic
928546638 2:32334940-32334962 CTCGGGGGCGGGGCGGGGCGGGG + Intergenic
929133665 2:38602739-38602761 CCCCGCGGACGGCCGGGCCGCGG - Exonic
929285950 2:40135462-40135484 CTTTGGGGGCGGCAGGGGAGGGG + Intronic
929777753 2:44939212-44939234 CTCCGGGGCTGGCCGGGCAGTGG + Intergenic
929829285 2:45334410-45334432 CTCGGGAGGCCGCCAGGGCGCGG + Intergenic
929949292 2:46393933-46393955 CTCCGGGGGTGGCGGGGGGGGGG + Intergenic
929966810 2:46542751-46542773 CTCCTGGGGAGGCCGGGCCGGGG + Exonic
931052317 2:58428523-58428545 CTCCGGGGCCGCCGGGGGCGGGG - Intergenic
931671777 2:64654014-64654036 CTCCCGGGACCGCCGGGGAGAGG - Intronic
931671949 2:64654658-64654680 CTTCGGGGCCGGCCGGGGCTCGG + Intronic
932496696 2:72149080-72149102 GGCGGCGGGCGGCCGGGGCGGGG - Intergenic
933133437 2:78701708-78701730 CCCCGGGAGGGGGCGGGGCGGGG + Intergenic
933858603 2:86441971-86441993 CGACGGGGGCGGCCGGTGGGAGG - Intronic
934966762 2:98730811-98730833 CTCCGGGAGCGGCTGGGCCTCGG - Intronic
935250137 2:101253426-101253448 CGCCGCGGGCGGGCGGCGCGGGG - Exonic
935275797 2:101474391-101474413 CGCGGGGGGCGCGCGGGGCGCGG + Intronic
935979371 2:108611632-108611654 CTCTGTGGGAGGCCGGGGCGTGG + Intronic
936038179 2:109129118-109129140 TCCCCGGGGAGGCCGGGGCGCGG - Intergenic
936713661 2:115161566-115161588 CCCCGGGGGCGGGCGGTGGGGGG + Intronic
937284560 2:120741833-120741855 CGCCGGCGGCGGCCGGTGTGCGG - Intronic
937301888 2:120847743-120847765 CTGCGTGGGGGGCAGGGGCGGGG + Intronic
937912937 2:127085034-127085056 CTCTGGGGTGGGGCGGGGCGGGG - Intronic
938018272 2:127885644-127885666 GTCCGGGGGCAGCGGGGGGGAGG - Intronic
938573797 2:132585603-132585625 TCCCGGGGGCGGCCGGAGCAGGG - Intronic
938909877 2:135876219-135876241 CTCCGGAGGCGGGCGAGGCCCGG + Intronic
940971974 2:159904799-159904821 GGCCGAGGGCGGCGGGGGCGGGG - Intergenic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
945102461 2:206274806-206274828 CTCCGCGGGCAGCGGGGCCGTGG + Exonic
945404041 2:209423919-209423941 GCCCGTGGGCGGCCGCGGCGGGG - Intergenic
946231287 2:218292514-218292536 CTCCGGGGCCGGGCAGGGCTAGG + Intronic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
946351855 2:219160568-219160590 CTCCGGGGGAGGGGTGGGCGGGG - Intronic
946354877 2:219178328-219178350 CTCGGGCGGCGGCTGCGGCGGGG + Exonic
946395522 2:219442091-219442113 CTCCGGGGGCGGGCGGCGCCGGG + Intronic
946412630 2:219522730-219522752 CCCCCGCGGCGGCCGGGGAGGGG - Intronic
946843258 2:223837822-223837844 CTCCAGGTGCGGCCGGCTCGGGG - Intronic
946929158 2:224655513-224655535 CTCCGGAGGCGGCTGAGGCCAGG - Intergenic
946966575 2:225042761-225042783 CTGCGGGGGAGGGCGGGGGGCGG + Intergenic
947399128 2:229714594-229714616 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
947418481 2:229921702-229921724 CGCCGGCGGCGGCGGGGCCGCGG - Intronic
947537268 2:230948102-230948124 CTGTGGGGGCGGCCAGGGGGTGG - Intronic
947623466 2:231605015-231605037 CTGCGGGCCCGGGCGGGGCGGGG + Intergenic
947992299 2:234497154-234497176 CCCCGGCGGCGGGCGGGGCGGGG - Intergenic
949019723 2:241734468-241734490 CTCCGGTGCCAGTCGGGGCGGGG + Intergenic
1168795892 20:610060-610082 CCCCGGGGGCGGGCGGCGGGCGG - Exonic
1169065515 20:2692702-2692724 GCCCGGGGGAGGCGGGGGCGGGG - Intergenic
1169074509 20:2752604-2752626 CTCCGGGATGGGCGGGGGCGGGG - Intronic
1169075113 20:2755604-2755626 CTCCGGGGCGGGGCGGGGAGGGG - Intronic
1170756798 20:19212471-19212493 CGGCGGGGGCGGCCGGGAGGCGG - Intergenic
1171012435 20:21515812-21515834 ACCCGGGGGCAGCTGGGGCGCGG - Intergenic
1172117011 20:32579024-32579046 CTCCGGGGATGGCAGGGGCCAGG + Intronic
1172656477 20:36541475-36541497 CTCCAGGCGGGGGCGGGGCGTGG - Exonic
1173297837 20:41775095-41775117 GGCTGGGGGCGGCCGGGGTGGGG - Intergenic
1173750139 20:45469964-45469986 TTCCGGGGGCGGAAGTGGCGGGG + Intronic
1173822696 20:46029407-46029429 GTCCGGGGGCGGCGGGGGAGGGG + Intronic
1174380711 20:50153734-50153756 CGCCGGGCGCGGCGGCGGCGCGG + Exonic
1174386396 20:50190588-50190610 ATCCCGGGGCGGCCGGGCGGGGG + Intergenic
1175338102 20:58209658-58209680 CCCCGGTGGGGGCGGGGGCGGGG - Intergenic
1175340934 20:58228594-58228616 CGGCGGGGGCGGGCGGAGCGCGG - Exonic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1175847097 20:62064983-62065005 CGCGGGGGGTGGCGGGGGCGGGG + Exonic
1175847109 20:62065009-62065031 CGGCGGGGGCGGCGGGCGCGGGG + Exonic
1175847309 20:62065558-62065580 CTCCGGGCGCGCCCTCGGCGGGG + Exonic
1175856363 20:62122861-62122883 CTCCGGGGCGCCCCGGGGCGGGG - Intronic
1175873835 20:62220356-62220378 CGCCGGGCGGGGCGGGGGCGGGG - Intergenic
1175927116 20:62476306-62476328 CTTCGGCGGGGGCCGGGGCAGGG - Intergenic
1175994116 20:62804780-62804802 CGCGGGGGGCGGGCGGGGGGAGG - Intergenic
1176041184 20:63066672-63066694 GTCCGGGGGCTGCCCAGGCGTGG - Intergenic
1176077513 20:63254984-63255006 CTCCACGGGCGGGCGGGCCGAGG + Intronic
1176120947 20:63454371-63454393 TGCCGGGGGCGGCCGGTGCAGGG + Intronic
1176157097 20:63627296-63627318 CCGCGCGGGCGGCCGGGCCGAGG + Intergenic
1176380722 21:6111069-6111091 GGCCGGGGCGGGCCGGGGCGGGG + Intergenic
1176380767 21:6111236-6111258 CTCCGGTGGCGGCGGAGGTGAGG + Exonic
1176422564 21:6527867-6527889 GCCCGGGGTCGGCAGGGGCGGGG + Intergenic
1176548054 21:8209881-8209903 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176555947 21:8254091-8254113 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176566985 21:8392916-8392938 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176574884 21:8437126-8437148 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176611499 21:8988422-8988444 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1177894548 21:26844432-26844454 CCCCTGGGGCGGCGGTGGCGAGG + Exonic
1178534903 21:33403340-33403362 CTCGGGGGCGGGACGGGGCGGGG + Exonic
1179626893 21:42653931-42653953 CGCCGGGGCCGGGCGCGGCGGGG + Intronic
1179698057 21:43136183-43136205 GCCCGGGGTCGGCAGGGGCGGGG + Intergenic
1179742705 21:43427004-43427026 CTCCGGTGGCGGCGGAGGTGAGG - Exonic
1179742750 21:43427171-43427193 GGCCGGGGCGGGCCGGGGCGGGG - Intergenic
1179796746 21:43789449-43789471 CTCCGGGGGCTGCAGTTGCGCGG + Intergenic
1180005616 21:45019146-45019168 GGCCGGGGGCGGCGGGCGCGGGG - Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180080296 21:45483584-45483606 CTCCGGGGGCGTCTGTGGTGGGG - Intronic
1180177926 21:46099009-46099031 CTCCAGGGGCGTCCTAGGCGCGG - Intronic
1180216088 21:46324528-46324550 CTCTCGGGCGGGCCGGGGCGGGG + Intronic
1180233682 21:46443575-46443597 CTCCGGGGGAGTGCGGGGCAGGG - Intronic
1180614762 22:17120215-17120237 CGCGGGGGGCGGCCTGGGGGCGG - Exonic
1180622503 22:17171563-17171585 CTCCGAGGGCACCCGGGCCGGGG + Intergenic
1181051013 22:20238298-20238320 CTGCGGCGGCGGCAGGGGTGGGG - Intergenic
1181064737 22:20300036-20300058 CGCGGGGTGCAGCCGGGGCGCGG + Intergenic
1181107744 22:20584856-20584878 CACCGGGGGCGGTGGGGGAGTGG - Exonic
1181169914 22:21002180-21002202 CACCGGGGCGGGGCGGGGCGAGG + Intronic
1181902783 22:26169674-26169696 CGCGGCGGGCGGCCGGGCCGCGG - Exonic
1182103016 22:27670876-27670898 CTGCGGGTGGGGGCGGGGCGTGG - Intergenic
1182122792 22:27798197-27798219 CTCTGGTGGCGGCGGTGGCGGGG - Exonic
1182880867 22:33732265-33732287 CTCGGGGAGCGGGCGGGGCTGGG + Intronic
1183326996 22:37199652-37199674 CTGCGGGGACGGCTGGAGCGTGG - Intergenic
1183903358 22:41022239-41022261 CTGCGGAAGCGGCCCGGGCGCGG - Intergenic
1184060736 22:42079601-42079623 CTCCTGGGGCGGCGGGAGGGAGG - Intergenic
1184276550 22:43412163-43412185 GACCGGAGGCGGGCGGGGCGCGG + Intronic
1184445306 22:44543762-44543784 CGGCGGGGGCGGGCGGGGGGCGG + Intergenic
1184711175 22:46250310-46250332 CACCGGGGTTGGCCGGGCCGCGG - Exonic
1184804165 22:46781698-46781720 CTCCGGGGCAGGCCAGGGAGGGG - Intronic
1185271082 22:49929553-49929575 CGGCGGGAGCGGGCGGGGCGCGG - Intergenic
1185285880 22:49999716-49999738 CGCGGGGGGTGGGCGGGGCGCGG + Intronic
1185317382 22:50185037-50185059 CTACCGGGGCGGCCGGGACCCGG - Intergenic
1185335800 22:50270392-50270414 CGGCGGCGGCGGGCGGGGCGGGG + Exonic
1185409414 22:50674363-50674385 CCCCGGGGGCGGGGGCGGCGGGG - Intergenic
1185409463 22:50674492-50674514 GGCCGGGGGGGGCCGGGGCCGGG - Intergenic
1203252933 22_KI270733v1_random:126181-126203 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203260988 22_KI270733v1_random:171262-171284 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950518074 3:13480293-13480315 CTCCGCGACCGGGCGGGGCGGGG - Exonic
950683719 3:14602395-14602417 CTCCGGGGTCGGCATGGGGGTGG + Intergenic
951962969 3:28349143-28349165 CTCCGCGGCGGGACGGGGCGGGG + Exonic
952287284 3:31981181-31981203 GTCCGTGGGCGCCCGGGACGCGG + Exonic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
952532848 3:34279883-34279905 ATCCGGGGGGGGGGGGGGCGGGG - Intergenic
953447360 3:42979559-42979581 CGCCGGGGGCGGCCAAGGGGAGG + Exonic
954632796 3:52056298-52056320 CTTCGGGGGCGGCGGCGGCTGGG - Exonic
955356584 3:58237459-58237481 TTCCGGGGCGGGGCGGGGCGGGG + Intergenic
956659336 3:71583081-71583103 GTCCGGTGGCCGCCCGGGCGCGG - Intronic
957072873 3:75579934-75579956 GTCCGGGGGTGCCGGGGGCGCGG - Intergenic
959056656 3:101574190-101574212 CTGCAGGGGAGGCCGCGGCGGGG + Exonic
960115086 3:113885267-113885289 CTCCGGGGCCGGCGGTGCCGGGG + Intronic
960120806 3:113947691-113947713 CTCTGGGGCGGGGCGGGGCGTGG + Intergenic
961081557 3:124033031-124033053 CTCCCCGGGAGGCCGGCGCGGGG + Intergenic
961281204 3:125766840-125766862 GTCCGGGGGTGCCAGGGGCGCGG + Intergenic
961377377 3:126475823-126475845 CTCCGCGCGCAGTCGGGGCGGGG + Exonic
961402030 3:126654591-126654613 CTCAGGGGACGACCGGGGAGAGG + Intronic
961446243 3:126983060-126983082 CTCCGCGGGCGGCGAGAGCGAGG + Intergenic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
961827573 3:129606866-129606888 TCCCGGGGGCGGGCGGGGCCGGG - Intergenic
961929371 3:130517096-130517118 GGCCCGGGGCCGCCGGGGCGGGG + Intergenic
962301847 3:134250493-134250515 CTCCGGGGGCCGCGGGGCGGGGG + Exonic
963091390 3:141486913-141486935 ACCCGGGGGGGGCGGGGGCGGGG + Intergenic
963236868 3:142964104-142964126 CTCCGGAGGTCGCCGGGGAGGGG + Intergenic
966402687 3:179563258-179563280 CTCCGGGGGCGGGCAGAGCGTGG - Intronic
966449866 3:180045991-180046013 GTTGGGGGGCGGCGGGGGCGGGG + Intergenic
966711914 3:182980406-182980428 GACGGAGGGCGGCCGGGGCGGGG + Intronic
967087301 3:186107673-186107695 TCCTGGGGGCGCCCGGGGCGCGG - Intronic
968230610 3:197002942-197002964 CTCCTGGGACGGCCTGGCCGCGG + Exonic
968450458 4:673881-673903 CCGCGGGCGGGGCCGGGGCGGGG - Intronic
968506548 4:973631-973653 ATCTGGGGGCTGGCGGGGCGGGG + Intronic
968547755 4:1207323-1207345 CGCCGGGGCCAGCCGGGGCCAGG - Intronic
968603387 4:1520738-1520760 TCCCCGGGGCGGCCTGGGCGGGG - Intergenic
968603426 4:1520820-1520842 TCCCCGGGGCGGCCTGGGCGGGG - Intergenic
968603446 4:1520861-1520883 TCCCCGGGGCGGCCTGGGCGGGG - Intergenic
968642309 4:1720931-1720953 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968642323 4:1720973-1720995 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968642337 4:1721015-1721037 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968642351 4:1721057-1721079 CCCCGCGGGCGGCCGGGCGGCGG - Exonic
968820183 4:2844065-2844087 CTGAGGCGGCGGCGGGGGCGCGG + Intronic
968831520 4:2934735-2934757 GACCGGGGGCGCCCGGGGTGGGG - Intronic
968907938 4:3463224-3463246 CTCCAGGGCCGGCGCGGGCGGGG - Intergenic
969016481 4:4107236-4107258 GTCCGGGGGTGCCGGGGGCGCGG - Intergenic
969213878 4:5708304-5708326 CTCCGGGGCGGAGCGGGGCGGGG - Exonic
969344731 4:6563632-6563654 CGGCGGGCGCGGCGGGGGCGCGG + Intergenic
969394219 4:6910040-6910062 GGCGGGGAGCGGCCGGGGCGAGG + Intronic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970456212 4:16226526-16226548 CTCCGGCGAGGGGCGGGGCGAGG - Exonic
972725855 4:41746062-41746084 CTCCGGGGGCGGCGGGGCCCGGG - Exonic
973635935 4:52862189-52862211 CTCCGGGGGCGTCGCGCGCGCGG + Intergenic
976344256 4:83981881-83981903 CTCCGGTGGGGGTCGGGGGGGGG - Intergenic
976431297 4:84966166-84966188 CTCCGGGAGCGCGGGGGGCGGGG + Intronic
977932166 4:102760999-102761021 CTAGGGGCGGGGCCGGGGCGGGG - Intergenic
979455638 4:120922838-120922860 CTGCGGGGGCGCGGGGGGCGCGG + Exonic
979674681 4:123398347-123398369 GGCCGGTGGCGGCGGGGGCGGGG + Intronic
980053681 4:128061126-128061148 CTCGGAGGGCAGCTGGGGCGGGG + Intergenic
981713564 4:147732027-147732049 CGCGGGGGCCGGGCGGGGCGGGG + Intergenic
981782050 4:148442100-148442122 CTCGGCGTGCGGCCGCGGCGCGG - Intronic
982042367 4:151409032-151409054 GGCCGGCGGCGGCGGGGGCGGGG + Intergenic
983537969 4:168878154-168878176 GACCGGGGGTGGCGGGGGCGGGG - Intronic
983649827 4:170026643-170026665 CTCTGGGGGCCGCCGAGGCCCGG - Intronic
984760209 4:183357031-183357053 CGGCGGGGCAGGCCGGGGCGGGG - Intergenic
985005972 4:185535571-185535593 CTCCGGGGTGGGAGGGGGCGGGG - Intronic
985437154 4:189941135-189941157 CTCCGGTGGAAGCCGTGGCGCGG + Intronic
985570206 5:640742-640764 TTCCGGGGGTGGCCGGGTCCCGG - Intronic
985593610 5:777892-777914 CACCGAGGGAGCCCGGGGCGGGG + Intergenic
985595202 5:784815-784837 CTGGTGGGGCGGCGGGGGCGGGG - Intergenic
985660712 5:1155519-1155541 CGCGGCGGGCGGCAGGGGCGGGG + Intergenic
985767480 5:1787569-1787591 CTTCGGGGGCAGCAGGGGCAAGG - Intergenic
985782042 5:1876587-1876609 CTACGGGAGCGGCCCGGGGGCGG - Intergenic
985810298 5:2078227-2078249 CTCCGGGGGTGGCCGGACCCTGG - Intergenic
986330616 5:6713913-6713935 CTCGGGGCGCGGCGGGGGCGGGG + Intergenic
986802260 5:11273955-11273977 TTCCTGGGGCGGCCAGGGAGGGG + Intronic
988564834 5:32312706-32312728 GGGCAGGGGCGGCCGGGGCGAGG - Intronic
989178731 5:38556248-38556270 CCCCAGGGGCGGCCCGGGCGGGG - Intronic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
990382995 5:55233760-55233782 CTCCGCGGCCCGCCGGGGGGAGG + Intergenic
991371611 5:65925711-65925733 CTGCGGCGGGGGCGGGGGCGGGG - Intergenic
991707106 5:69369227-69369249 CTCCGGGGGGGGGCGGGGGGGGG - Intronic
992078978 5:73216419-73216441 CTCCGGGGGCGGCAGAGCCTGGG - Intergenic
992105630 5:73447562-73447584 ATGCGGGGGCGGCGGGGGCGCGG + Exonic
994043444 5:95284051-95284073 CCTCGGGGGAGGCTGGGGCGAGG + Exonic
997103727 5:130995334-130995356 CCCCGGGGGCGCCTGGAGCGGGG - Intergenic
997265230 5:132491140-132491162 CTCCTGGCGGGGCGGGGGCGGGG + Intergenic
997704113 5:135930640-135930662 CTTCGGGGGCGGCCGGGCCCGGG - Intronic
998076300 5:139239469-139239491 CACCGCGCCCGGCCGGGGCGAGG - Intronic
998130621 5:139649535-139649557 CCCCGCGGGCAGCGGGGGCGAGG - Intronic
998152335 5:139764595-139764617 CGCCGGGGGAGGGCGGCGCGCGG - Intergenic
998467447 5:142357147-142357169 AAGCGGGGGCGGCCGGAGCGCGG - Intergenic
999248271 5:150166977-150166999 CTGCGGGGGCGCCGGGGGCGGGG - Exonic
999279728 5:150357473-150357495 CCCCGGGGCCGGCCGGGACTTGG - Intergenic
999786949 5:154899271-154899293 CTCCGGGCGCAGCCGGGCCTTGG + Exonic
1000040618 5:157481914-157481936 CTTCTGGGGCGGCCGAGGCCTGG + Exonic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1002057989 5:176609784-176609806 CGCCGGGGCGGGGCGGGGCGGGG - Intronic
1002189926 5:177473021-177473043 GTCCGGGCGGGGACGGGGCGGGG - Exonic
1002429302 5:179193874-179193896 CTCCAGGGGCAGCCTGGGAGGGG + Intronic
1002580851 5:180208874-180208896 CGCCGGGGTCAGCAGGGGCGGGG - Intronic
1003175859 6:3751864-3751886 CTGCGGAGGCGGCGGGGGCGCGG - Exonic
1003544900 6:7051436-7051458 CCCCGAGGGCGGCTGCGGCGCGG + Intergenic
1003551538 6:7106497-7106519 CTACGGGGGCGGGGGGGGGGGGG + Intergenic
1003567004 6:7230424-7230446 CTGCGGCCGCGGCCTGGGCGGGG + Exonic
1003603639 6:7541424-7541446 CACCGGGCGGGGCGGGGGCGGGG - Intergenic
1004216780 6:13711248-13711270 CGGCGGGGGCGGCGGGGCCGCGG + Exonic
1004639937 6:17505454-17505476 GTCCGGGGGTGGCCTGGGTGAGG - Intronic
1004650251 6:17600891-17600913 CTGCGGGGGCGGCGGCGCCGCGG - Exonic
1005533587 6:26733118-26733140 CTCGGTGGGAGGCCGAGGCGGGG + Intergenic
1005535063 6:26746558-26746580 CTCGGTGGGAGGCCGAGGCGGGG - Intergenic
1005537208 6:26768536-26768558 CTCGGTGGGAGGCCGAGGCGGGG - Intergenic
1005765887 6:29011703-29011725 CTCTGGGGCGGGGCGGGGCGGGG + Intergenic
1006047355 6:31308724-31308746 CTCCGGTGCCGGGCGGGACGTGG - Intronic
1006177512 6:32131308-32131330 CGGCGGGGGGGGGCGGGGCGGGG + Intergenic
1006239497 6:32665098-32665120 CTGCGGGGGCGGCCGGGCTGGGG - Intronic
1006396227 6:33789127-33789149 CGCCAGGGGCGGGCGGGGGGCGG - Exonic
1006641078 6:35490214-35490236 CTCCCGCGGGGGGCGGGGCGGGG - Intronic
1006725502 6:36196795-36196817 CGGCGGCGGCGGCCGGGCCGGGG + Exonic
1007361365 6:41358703-41358725 CTATGGGGGCGGGCGGGGGGTGG - Intergenic
1007371103 6:41427611-41427633 CCCCGGGGCAGGCCGGGGGGAGG - Intergenic
1007444518 6:41895031-41895053 GGCTGGGGGCGCCCGGGGCGGGG - Intronic
1007558079 6:42783054-42783076 ATCTGCGGGCGGCCGCGGCGAGG + Intronic
1007737695 6:43991804-43991826 GGTCGGGGGCGGCGGGGGCGGGG + Intergenic
1007779807 6:44246381-44246403 CTCCGGCTGCGGCCGGGGCAGGG - Intronic
1007784083 6:44270521-44270543 GGCCGGGGGGGGCCGGGGCCGGG - Exonic
1010083072 6:71886636-71886658 CTCCGGCGGGGCGCGGGGCGGGG - Intergenic
1011640443 6:89412198-89412220 CTCCGCCGGCGGGCGGGGCGGGG - Exonic
1012465960 6:99516083-99516105 TTCAGGGGGCGGCGGGGGTGTGG - Intronic
1012582032 6:100881202-100881224 CTTGGAGGGCGGACGGGGCGCGG - Exonic
1013369467 6:109456348-109456370 ATCCTGGGGCGCCCGGGCCGTGG - Intergenic
1013459020 6:110358013-110358035 CGCCGGGCGCCGCCGGGGGGCGG - Exonic
1013793689 6:113860434-113860456 CTCCGGGGGCGCGCCGGGCCCGG - Exonic
1015625766 6:135180502-135180524 CGCCTGGGCCGGGCGGGGCGGGG + Intergenic
1016949449 6:149566259-149566281 CTCCCCGGGCGGCCGCGGAGAGG - Intergenic
1016949452 6:149566262-149566284 CTCCGCGGCCGCCCGGGGAGGGG + Intergenic
1017672499 6:156779568-156779590 CCGCGGGGGCGGCGGGGGCGCGG + Intronic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019309721 7:354072-354094 CTGCAGGGGCGGCCAGTGCGGGG + Intergenic
1019343718 7:519917-519939 ATCCGGGGGAGGCGGGGGGGGGG - Intronic
1019352604 7:562018-562040 CTCCCGGCGCGGCCGGGGGGTGG + Intronic
1019356581 7:583039-583061 GTCCGGGGGCTGCCAGGGCCGGG + Intronic
1019379094 7:712161-712183 CTCCGGGGGCGGCGTGGCGGGGG - Intronic
1019472759 7:1229986-1230008 CTGCGGGGGCGGCGGGTGGGTGG + Intergenic
1019474373 7:1236832-1236854 CGGCGCGGGCGGCGGGGGCGCGG - Exonic
1019509011 7:1407928-1407950 CCCAGGGGGCAGCAGGGGCGGGG + Intergenic
1019522422 7:1466920-1466942 CTCCAGGCGGGGACGGGGCGGGG - Intergenic
1019578836 7:1750261-1750283 CTCCCCGGGGGGCCGGGGCCGGG - Intergenic
1019765100 7:2844179-2844201 CCCCGGGCGCCGGCGGGGCGCGG - Exonic
1019884804 7:3894438-3894460 CTCCGGGGGTGGTGGGGGAGTGG + Intronic
1020178102 7:5898804-5898826 CTGCAGCGGCGGCCGGGGCCGGG + Exonic
1020274298 7:6615510-6615532 CGGCGGCGGGGGCCGGGGCGCGG + Intergenic
1020278230 7:6637283-6637305 CCGCGGGCGCGGGCGGGGCGGGG + Intergenic
1020304825 7:6826171-6826193 CTGCAGCGGCGGCCGGGGCCGGG - Exonic
1021106814 7:16646618-16646640 CTCCCGGGGAGGCTGGGGCCGGG + Intronic
1022105404 7:27192992-27193014 CTCCTGGGGAGGGCGGGGCGGGG + Intergenic
1023791864 7:43758894-43758916 CTCCGGGCCCGGGCGGGGCGGGG - Intronic
1023918300 7:44606909-44606931 CTCCGAGGTCGCGCGGGGCGCGG + Intronic
1024940537 7:54759044-54759066 CTCCCCGGGCGGCCGTCGCGGGG - Intronic
1026025594 7:66741251-66741273 CCCCGGCCGCGGCAGGGGCGCGG + Intronic
1027138243 7:75639308-75639330 CGCCGGGGGCGGGGGAGGCGCGG + Intronic
1027654985 7:80919238-80919260 CCGCGGGGGCGGACCGGGCGGGG + Exonic
1029080756 7:97972228-97972250 CTGCAGCGGCGGCCGGGGCTGGG - Intergenic
1029110554 7:98211376-98211398 CTCGGGGCGGGGCCGGGGCGGGG - Intergenic
1029363021 7:100100843-100100865 CCCCGGGGGCGGGCAGGCCGGGG - Intronic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029440804 7:100585803-100585825 CTCCCGGGCCGGGCGGGGCCCGG + Intronic
1029490080 7:100866190-100866212 CGCCTGGGGCGGCCGAGGGGCGG + Exonic
1029730131 7:102433494-102433516 CTGCGGCGGCCGCGGGGGCGGGG + Intronic
1029743366 7:102503514-102503536 CTCTGGGGGTGGCAGGGGGGTGG + Intronic
1029761355 7:102602675-102602697 CTCTGGGGGTGGCAGGGGGGTGG + Intronic
1030176502 7:106660423-106660445 CTCGGGGGGCGGCGGCGGTGGGG + Exonic
1031051877 7:116953429-116953451 CTCCGGGGGCGCCCGGGCCGCGG + Exonic
1031401315 7:121328934-121328956 CTCCAGGCGCGGCCAGGGGGAGG + Intronic
1031899634 7:127393928-127393950 CTACGGGAGAGGCGGGGGCGGGG + Intronic
1031997242 7:128240925-128240947 CGCGGGGCGCGGTCGGGGCGGGG - Intergenic
1032074644 7:128830604-128830626 CTGGGGGTGCGGCCGGGGCTAGG - Exonic
1032119329 7:129144995-129145017 CCCCGGAGGCGGCCGGCGCCCGG - Exonic
1033253095 7:139777508-139777530 CGCCGGGGGCTGCGGGCGCGGGG + Intronic
1033654025 7:143361791-143361813 CAGCGGGGGCCGGCGGGGCGGGG - Intronic
1034201429 7:149285327-149285349 CTCGCGGGGCCGCCGGGGCTCGG - Intronic
1034344812 7:150379549-150379571 CTCGGGGGGCGCGCGGGGCTCGG - Intronic
1034423383 7:151000640-151000662 ATACGGGGGCAGCAGGGGCGGGG + Intronic
1034434716 7:151057935-151057957 CTGCGCGGGCAGACGGGGCGGGG - Exonic
1034522530 7:151632011-151632033 GTCCTCGGGCGGCCGGGCCGTGG + Intronic
1034617930 7:152435520-152435542 CGCCGGGGGGCGCCGGGGCGCGG + Intronic
1034625799 7:152491382-152491404 CTCAGGGGGCGGGCGGGGGCGGG + Intergenic
1036578829 8:10054401-10054423 ACCGGGGGGCGGCAGGGGCGCGG - Exonic
1036764913 8:11543328-11543350 CACCAGGGGCGGCAGTGGCGGGG - Exonic
1036900311 8:12665234-12665256 GTCCGGGGGTGCCGGGGGCGCGG - Intergenic
1037547719 8:19940014-19940036 CTTCTGGGGAAGCCGGGGCGCGG + Intronic
1037833837 8:22204724-22204746 TTGCGGGGGCGGGCGGGGTGGGG - Intronic
1038287327 8:26217106-26217128 ATCCTGGGGAGGCGGGGGCGGGG + Intergenic
1038326618 8:26577281-26577303 CTCCGGGGCCGGGCGTGGCCGGG + Intronic
1038543923 8:28411692-28411714 TCCCGGCGGCGGCCGGCGCGGGG - Intronic
1038883760 8:31640635-31640657 CTCGGAAGGCGGCCGGCGCGCGG - Intronic
1039837516 8:41268770-41268792 ATCCCGGGGCTGCTGGGGCGAGG + Intronic
1039895524 8:41714121-41714143 CTCCAGGGGCAGCTGGGGAGAGG + Intronic
1039996957 8:42541953-42541975 CTGCCGGGGCGGCGGGGGCTCGG + Intronic
1040038998 8:42897302-42897324 GGCCTGGGGCGGGCGGGGCGAGG + Intronic
1040080104 8:43276201-43276223 CTGTGGGGGCGGGCGGGGTGAGG + Intergenic
1040355886 8:46617710-46617732 CTCGCGGGGCGGCTGGGGCGGGG + Intergenic
1042784967 8:72536962-72536984 CCCAGGGCGCGGCTGGGGCGCGG - Intergenic
1043742735 8:83834307-83834329 CTCCGGGGGCCGCTGTGGGGTGG + Intergenic
1045216168 8:100150563-100150585 CGCCTGGGGCGGAAGGGGCGGGG + Exonic
1045269443 8:100649554-100649576 CTGCGGCGGCGGGCGGTGCGCGG + Exonic
1045582658 8:103498811-103498833 CTCCCGGAGGGGGCGGGGCGGGG - Intergenic
1045847673 8:106657552-106657574 GTCCGAGCGCGGACGGGGCGGGG + Intronic
1045847814 8:106658141-106658163 CGCCGGGGGCCGGTGGGGCGGGG - Intronic
1045853691 8:106736166-106736188 CTCTGGGGGCGGATGGGGGGGGG - Intronic
1048981151 8:139703864-139703886 CTTCGGGGGCGGCCGGGGGACGG + Intergenic
1049101201 8:140580211-140580233 TTCCCGGGGCTGCCGGGGTGGGG - Intronic
1049212178 8:141391904-141391926 CCTCGGGGGCGGCGGGCGCGCGG + Intergenic
1049220104 8:141425178-141425200 CACCGGGGGAGGGTGGGGCGGGG + Intronic
1049398529 8:142413056-142413078 CTCAGGGGGAGGGCGGGGCTGGG + Intergenic
1049409036 8:142464276-142464298 CTCCGGCGGCCGCCCGCGCGCGG - Exonic
1049419485 8:142510587-142510609 AGCTGGGGGCGGCGGGGGCGCGG + Intronic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049621071 8:143598562-143598584 GGCCGGGGGCGGCGGGGCCGGGG - Exonic
1049675567 8:143887439-143887461 CTCGGGCGCCGGCCGGGGCTAGG - Intergenic
1049707372 8:144049168-144049190 CGCCGGGGGCGGGAAGGGCGAGG - Intergenic
1049746817 8:144266521-144266543 CTCGCGGGCCGGCCGGGGCGAGG - Intronic
1049778958 8:144418774-144418796 CGCTGTGGGAGGCCGGGGCGGGG + Intergenic
1049785627 8:144449328-144449350 ATCAGGGGGCGGCCAGGGTGAGG + Intergenic
1049788525 8:144462612-144462634 CGGCGGGGGCGGCCCGGCCGCGG - Intronic
1049879506 8:145052382-145052404 CGCGGGGCGCGGGCGGGGCGCGG - Exonic
1050151285 9:2621790-2621812 CACCGGCGGCGGCCGGAGAGCGG - Intergenic
1053250829 9:36572842-36572864 CTCCCGGGCCGGAAGGGGCGGGG - Exonic
1053312373 9:37027728-37027750 CTCCGGGCGGGGGCGGGGCGGGG + Intronic
1053435173 9:38069323-38069345 CTGCGGGAGCGGGCGGGGGGCGG - Intergenic
1053620464 9:39809468-39809490 CTCCGGGGGCGGCCATACCGAGG + Intergenic
1054263694 9:62897975-62897997 CTCCGGGGGCGGCCATACCGAGG - Intergenic
1054340740 9:63859667-63859689 CTCCCGGGGCGGGGGGGGGGCGG + Intergenic
1054870549 9:70044280-70044302 CCCCGGGGGCAGCAGGAGCGGGG - Intronic
1055030773 9:71769569-71769591 CACTGGGGTGGGCCGGGGCGTGG - Intronic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1057689582 9:97271517-97271539 CTCTGGGGCTGGCCGAGGCGGGG - Intergenic
1057716672 9:97501565-97501587 AGCCGGCGGCGGGCGGGGCGGGG + Intronic
1057772958 9:97983803-97983825 CCCCTGGGGCGGCCGGGGGGAGG + Intronic
1059197032 9:112380047-112380069 CATCGGGGGGGGCAGGGGCGGGG + Exonic
1060087282 9:120714214-120714236 CACCGGTGGCGGCGGGGCCGCGG - Exonic
1060700620 9:125746975-125746997 CCCCCGGGGCCGCCGGGGCTCGG + Intergenic
1060733112 9:126050316-126050338 CTCATGGCGAGGCCGGGGCGGGG - Intergenic
1060744796 9:126124208-126124230 CTCCTGGGGCGGGGGGGGGGGGG - Intergenic
1060811553 9:126613710-126613732 CCCGCGGGGCGGCCGGGCCGGGG + Intergenic
1060936952 9:127521556-127521578 CTCCGGGGGCTGCCAGGAAGTGG - Intronic
1061002476 9:127910180-127910202 CTCTGGGGGAGGCTGGGGAGGGG + Intronic
1061050322 9:128191403-128191425 GGCCGGGGGCGGCTGGGTCGTGG - Intronic
1061084786 9:128392602-128392624 CTCCGGGCGCAACAGGGGCGGGG - Intergenic
1061317156 9:129803443-129803465 CTGCGGGGGGCGCGGGGGCGCGG + Intronic
1061450201 9:130663573-130663595 CTCACGGGGCTGCCGAGGCGGGG - Intergenic
1061580216 9:131531558-131531580 GCCCGGGGGCGGCCGGGGGAGGG - Intergenic
1061609880 9:131739548-131739570 CTGCGGGGGCGCCAGGGGCCGGG - Intronic
1061803400 9:133125303-133125325 CTCCAGGGGCGGGCAGGGAGTGG + Intronic
1061843804 9:133375814-133375836 GTCAGGGGGCGGCCCGGGCCTGG + Intronic
1061859370 9:133460255-133460277 CCCCTGGGGCCGCCGGGGCGGGG - Intronic
1062038726 9:134394551-134394573 CTCTGGGGGAGGCCCGGGCAGGG + Intronic
1062230638 9:135479891-135479913 CTCCGCCCTCGGCCGGGGCGCGG - Exonic
1062320400 9:135988018-135988040 CTCTGGGGCCGGGCGGAGCGCGG + Intergenic
1062398212 9:136361114-136361136 GCCCGTGGGAGGCCGGGGCGCGG - Intronic
1062414280 9:136439868-136439890 CTGTGGGCGGGGCCGGGGCGCGG - Intergenic
1062444503 9:136587968-136587990 TTGCGGGGGAGGCGGGGGCGGGG + Intergenic
1062537753 9:137028315-137028337 AAGCGGGGGCGGGCGGGGCGCGG - Intronic
1062556219 9:137114428-137114450 CGGCGGGGGCGGCCGGGCCGGGG + Intronic
1062565801 9:137163477-137163499 CTGGGGGCGGGGCCGGGGCGGGG - Intronic
1062653424 9:137590118-137590140 TGCGGGCGGCGGCCGGGGCGGGG - Intronic
1203469335 Un_GL000220v1:109328-109350 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203477156 Un_GL000220v1:153300-153322 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185471534 X:386725-386747 CCCCGGGGCGGGGCGGGGCGCGG - Intronic
1185747554 X:2584458-2584480 CCCTGGGGGCGGCCGGGAGGAGG + Intergenic
1185877768 X:3713780-3713802 CCCCGGGCGCGGAGGGGGCGTGG - Intergenic
1187225830 X:17375105-17375127 GGGCGGGGGAGGCCGGGGCGAGG - Intergenic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1192630954 X:72777482-72777504 GGCGGGGGGCGGCGGGGGCGCGG - Intronic
1192650755 X:72943319-72943341 GGCGGGGGGCGGCGGGGGCGCGG + Intronic
1193513090 X:82430577-82430599 CTCCGGGGCGGGGCGGGGGGTGG - Intergenic
1196707339 X:118727683-118727705 CTGCGCCGGCGGCGGGGGCGGGG + Exonic
1197754446 X:129984127-129984149 CTCCGGCGGGCGGCGGGGCGGGG + Intronic
1198256153 X:134925859-134925881 CTCCGGAGGCAGCAGGGGCCCGG - Intergenic
1198348638 X:135784521-135784543 CTCCCGGTGCCGCCGGGGAGTGG - Intergenic
1198352450 X:135819058-135819080 CTCCCGGTGCCGCCGGGGAGTGG - Intronic
1198354359 X:135836326-135836348 CTCCCGGTGCCGCCGGGGAGTGG - Intronic
1198480222 X:137033923-137033945 CTGCGGGCGCGGCAGGAGCGGGG + Intergenic
1200002595 X:153069703-153069725 GGGCGGGGGCGGCCGAGGCGGGG + Intergenic
1200005129 X:153080307-153080329 GGGCGGGGGCGGCCGAGGCGGGG - Intergenic
1200057808 X:153470726-153470748 CTCTGGGTGGTGCCGGGGCGGGG - Intronic
1200100796 X:153688437-153688459 GCCGGGGGGCGGCCGGGCCGGGG - Exonic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic
1200787555 Y:7273759-7273781 CCCCGGGCGCGGAGGGGGCGTGG + Intergenic
1202368640 Y:24183073-24183095 CTCTGGGGGTGGCCGGGGCTGGG - Intergenic
1202502145 Y:25487044-25487066 CTCTGGGGGTGGCCGGGGCTGGG + Intergenic