ID: 1148931016

View in Genome Browser
Species Human (GRCh38)
Location 17:51127394-51127416
Sequence GTGGCGTATTTGTAGTTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148931016_1148931024 24 Left 1148931016 17:51127394-51127416 CCTACTAACTACAAATACGCCAC No data
Right 1148931024 17:51127441-51127463 CTTTTTATCGAGACAAGGTCTGG No data
1148931016_1148931023 19 Left 1148931016 17:51127394-51127416 CCTACTAACTACAAATACGCCAC No data
Right 1148931023 17:51127436-51127458 TTTTACTTTTTATCGAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148931016 Original CRISPR GTGGCGTATTTGTAGTTAGT AGG (reversed) Intergenic
No off target data available for this crispr