ID: 1148932217

View in Genome Browser
Species Human (GRCh38)
Location 17:51136400-51136422
Sequence ATAGAGAGACAGCTAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148932214_1148932217 16 Left 1148932214 17:51136361-51136383 CCTGTGACATTAGTGAGCTGTCT No data
Right 1148932217 17:51136400-51136422 ATAGAGAGACAGCTAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148932217 Original CRISPR ATAGAGAGACAGCTAGAGGG AGG Intergenic
No off target data available for this crispr