ID: 1148935433

View in Genome Browser
Species Human (GRCh38)
Location 17:51161227-51161249
Sequence TCCACGGATGGTCCCAGGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148935433_1148935437 -3 Left 1148935433 17:51161227-51161249 CCAAGCCTGGGACCATCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1148935437 17:51161247-51161269 GGAGACTTCTGCATACAAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 84
1148935433_1148935439 12 Left 1148935433 17:51161227-51161249 CCAAGCCTGGGACCATCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1148935439 17:51161262-51161284 CAAGTTGGCAGGTGAGATTTTGG 0: 1
1: 0
2: 3
3: 24
4: 161
1148935433_1148935438 1 Left 1148935433 17:51161227-51161249 CCAAGCCTGGGACCATCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1148935438 17:51161251-51161273 ACTTCTGCATACAAGTTGGCAGG 0: 1
1: 0
2: 2
3: 10
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148935433 Original CRISPR TCCACGGATGGTCCCAGGCT TGG (reversed) Exonic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901011630 1:6205862-6205884 TCCAGGGACGGTGCCAGGCAAGG - Intronic
901840271 1:11949925-11949947 TCCGCGGAGGGGCCCAGGCTAGG - Intronic
902839266 1:19065109-19065131 GGCAGGGATGGGCCCAGGCTGGG - Intergenic
904254849 1:29248345-29248367 TCCAGTGTTGGTTCCAGGCTTGG + Intronic
904620235 1:31770824-31770846 ACCTCAGAGGGTCCCAGGCTTGG + Intergenic
904925953 1:34048382-34048404 CCCTCAGATGGTGCCAGGCTAGG + Intronic
906517027 1:46445641-46445663 TCCTCAGATGGGCCCAGGATGGG + Intergenic
915562290 1:156694270-156694292 CTCACGGATGGGGCCAGGCTGGG + Intergenic
917450017 1:175140326-175140348 TCCAGGGAGGGTCCCACGCATGG - Intronic
922756682 1:228100905-228100927 ACCAGGGATGGCCCCTGGCTTGG - Exonic
924333471 1:242964027-242964049 TCCAGGGCTGCTCCAAGGCTGGG - Intergenic
1065189424 10:23196465-23196487 TCCCCTGGTGGTCCCAGGCTGGG - Intergenic
1065496624 10:26335787-26335809 TCCAGGGATTGTCACAGCCTCGG + Intergenic
1067094736 10:43292896-43292918 TCCAGGGAGGGCCCCAGGCTTGG + Intergenic
1067841069 10:49679828-49679850 TGCACGGATGCTCAGAGGCTGGG - Intronic
1076198664 10:128540489-128540511 TCCACGGATGGGGGCCGGCTGGG - Intergenic
1076383145 10:130038683-130038705 GCCAAGGATGGCCCCAGGCATGG - Intergenic
1076567441 10:131408450-131408472 TCCACGGCTAGCCCCAGTCTGGG + Intergenic
1076829088 10:132985352-132985374 TCCAAGGATCTTCCCAGGCAAGG - Intergenic
1077414369 11:2417967-2417989 TCTGCGGGTGGTCCCAGGCCGGG - Intronic
1077537311 11:3130555-3130577 TCCAAGGATGCAGCCAGGCTGGG + Intronic
1079365707 11:19807547-19807569 CCAAGGGATGGTTCCAGGCTGGG - Intronic
1082906576 11:58313768-58313790 TCCACTGAGGGTCCCAAGTTGGG + Intergenic
1082942005 11:58716082-58716104 TCTAAGAATGGACCCAGGCTAGG - Intronic
1084485757 11:69447288-69447310 TCCAAAGCTGGACCCAGGCTTGG + Intergenic
1085040882 11:73325641-73325663 TCCAGGGAAGGTCTCAGGCTCGG - Intronic
1088364018 11:109019981-109020003 ACCACAGATGGTCGCAGACTTGG + Intergenic
1089512762 11:119010896-119010918 TCCACAGATGGACCCAGGCAGGG + Intronic
1091414543 12:269890-269912 TCCACAGCTGATCTCAGGCTTGG + Intergenic
1095401215 12:41816527-41816549 TCCAGGGATGGTTCCTGCCTTGG - Intergenic
1097233677 12:57526347-57526369 GCCACTGGTGGTCCCAGGCAGGG - Exonic
1099551301 12:84046740-84046762 TCCACTGATGGACACAGGTTGGG + Intergenic
1100260411 12:92928493-92928515 CCCACGCCTGGGCCCAGGCTAGG + Intronic
1106247502 13:27961928-27961950 TCCAAGGCTGGGCTCAGGCTTGG + Intergenic
1113714775 13:112495344-112495366 TGCACTGATGGTCCCAGCCAGGG - Intronic
1121342128 14:93111757-93111779 TACAAGGTTGCTCCCAGGCTAGG + Intronic
1121536089 14:94691578-94691600 TCCACTGTCTGTCCCAGGCTTGG + Intergenic
1122823995 14:104360848-104360870 TCCAGGGAGGGGCTCAGGCTGGG + Intergenic
1124559494 15:30758563-30758585 CCCACTGATGGTCCCAGCCCCGG - Intronic
1124671756 15:31647155-31647177 CCCACTGATGGTCCCAGCCCCGG + Intronic
1129056154 15:72821865-72821887 TCCTCAGCTGGTCCAAGGCTGGG + Intergenic
1130300115 15:82674207-82674229 GCCACTCATGGTCCCAGGATGGG + Intronic
1136068845 16:27776209-27776231 TCTGAGGATGGTCACAGGCTGGG + Intronic
1136070604 16:27784831-27784853 ATGACTGATGGTCCCAGGCTGGG + Intergenic
1136415204 16:30098687-30098709 TCCACTGAGGGTCCTGGGCTGGG - Intergenic
1141388636 16:83646097-83646119 TTCACGTATGGTCCCACACTAGG - Intronic
1142707940 17:1708394-1708416 TCCATAGATGGAACCAGGCTTGG + Intronic
1146940730 17:36842781-36842803 TGCACAGAGGGTCCCAGGCTGGG - Intergenic
1147328719 17:39683813-39683835 TCCAGGGATGGTCTAAGCCTAGG + Intronic
1148935433 17:51161227-51161249 TCCACGGATGGTCCCAGGCTTGG - Exonic
1150710267 17:67525247-67525269 TCCACGGCTGGGTCCAGTCTGGG - Intronic
1152634153 17:81423576-81423598 TCCTGGAATGGTCCCAGGCCAGG + Intronic
1155084177 18:22440461-22440483 TCCAAGGTTGGGCACAGGCTAGG - Intergenic
1160919897 19:1514391-1514413 ACCACTGATGGCCCCAGGTTGGG + Intergenic
1160974267 19:1784987-1785009 TCCAAGGATGCCCCCAGGCTAGG + Intronic
1161206721 19:3045302-3045324 TTCACGCATGGTCCCAGGTAGGG - Intronic
1162013254 19:7830514-7830536 TCCTCCGAAGGTCCCGGGCTGGG - Intronic
1162474135 19:10889720-10889742 TCCACGGTTGGATCCGGGCTTGG - Intronic
1163366362 19:16878086-16878108 TCTTCTGATGGTCCCAGGCCTGG + Intronic
1165418139 19:35707689-35707711 TCAACAATTGGTCCCAGGCTGGG + Intronic
1166253591 19:41587106-41587128 TTCACAGAGGGACCCAGGCTGGG - Intronic
1166257777 19:41618733-41618755 TTCACAGAGGGACCCAGGCTGGG + Intronic
1166689828 19:44815707-44815729 TCTAAGGAAGGTCTCAGGCTGGG + Intronic
925294919 2:2769886-2769908 TCCACGGCTTCTCCCAGGCCTGG - Intergenic
931248341 2:60509376-60509398 TCCACGGTTAGCCCCTGGCTTGG - Intronic
933436983 2:82260865-82260887 CCCACCGAGGGTCCCAAGCTGGG + Intergenic
935179040 2:100674127-100674149 TCCACTGTGGGTCCCAGGGTGGG - Intergenic
948366529 2:237458435-237458457 TCCTCTCATGGTCACAGGCTGGG + Intergenic
1169611010 20:7380147-7380169 TCCCTGGATGGTCACAGACTTGG - Intergenic
1172628477 20:36362411-36362433 TCCAGGGAAGGTCACAGACTGGG + Intronic
1173925225 20:46776325-46776347 ACCCCTGATGGTTCCAGGCTCGG - Intergenic
1175494330 20:59403551-59403573 TCCTAGGATGCTCCCAGGCCTGG + Intergenic
1178417905 21:32418689-32418711 TACAGGGATGGGGCCAGGCTGGG + Intronic
1183610619 22:38901595-38901617 CCCACTGATGGTACCAGGCAGGG + Intergenic
1184681828 22:46076421-46076443 TCCACGGACCGTCCCAGCCCAGG - Intronic
954699509 3:52443921-52443943 TCCACGGATGGGCCCAGGGAAGG - Intronic
955044842 3:55350203-55350225 CCCACGGATGGTACCAGACCTGG + Intergenic
957976141 3:87447633-87447655 TGAAGGGATGGACCCAGGCTTGG - Intergenic
961887521 3:130106132-130106154 TCCACAGCTGGTCCCATCCTAGG + Intronic
962073731 3:132058396-132058418 TCCACAGGTGGTCTCAGACTTGG - Intronic
963083342 3:141414840-141414862 TCCTCAGATTGTCCCAGTCTAGG - Intronic
965749890 3:171965166-171965188 TCCACGGATTTTCCTATGCTGGG - Intergenic
969247832 4:5947018-5947040 GCCAGGGAAGGTCACAGGCTTGG + Intronic
976647339 4:87399922-87399944 TCCACGGATGGCCTGAGGCCTGG + Intergenic
977173398 4:93790119-93790141 TCCACGGATGGGCACGGGGTAGG - Intergenic
981271795 4:142854238-142854260 ACCAGGGATGATTCCAGGCTGGG - Intergenic
982827545 4:160019646-160019668 TCCCTGGATGCTCCCAAGCTAGG - Intergenic
985969810 5:3366029-3366051 TCCAGGGTGGGTCCCAGGATGGG - Intergenic
986210222 5:5664959-5664981 TCCACTGGTGGACCCAGCCTCGG - Intergenic
987106786 5:14647470-14647492 CCCACAGATGGTCCAAGGGTGGG + Intergenic
987132658 5:14872551-14872573 TCCCCGCAGGCTCCCAGGCTGGG + Intergenic
987642710 5:20633177-20633199 TTCACAGCTGGTCCCAGCCTGGG - Intergenic
988216679 5:28284016-28284038 TCCAAGTCTTGTCCCAGGCTAGG + Intergenic
990512682 5:56503008-56503030 CCCAGGGATGATCACAGGCTGGG + Intergenic
991010088 5:61873187-61873209 TACACGGATGGTAGCAGGCAAGG + Intergenic
992323000 5:75632503-75632525 TTCAGGGATGGTCACATGCTAGG - Intronic
997580372 5:135013112-135013134 TCCAGGGATGACGCCAGGCTTGG + Intergenic
998508776 5:142694248-142694270 TGCACAGAAGGTCCCAGGCCAGG - Intronic
999532004 5:152474044-152474066 TCAAAGGGTGGTCCCAGGATGGG - Intergenic
1002329961 5:178434541-178434563 CCCAGGGAAGGCCCCAGGCTGGG - Intronic
1004741248 6:18463483-18463505 TCCCCAGAAGCTCCCAGGCTGGG - Intronic
1007072475 6:39047760-39047782 CCCACGGCAGGTCCGAGGCTGGG + Intergenic
1007493492 6:42242954-42242976 ACCAAGGATGGTCCCAGCCTTGG - Intronic
1013433317 6:110075906-110075928 TCCACAGATTTTCCCATGCTTGG - Intergenic
1017889090 6:158624707-158624729 TCCAAGAAAGGACCCAGGCTAGG - Intronic
1019310435 7:357779-357801 TCCAAGCAGGGTCCCAGGGTGGG - Intergenic
1019721145 7:2572220-2572242 TCCACGCATGCTCCCAGGTGAGG - Exonic
1019892408 7:3956740-3956762 AACACAGATGGTCCCTGGCTAGG + Intronic
1019932853 7:4235091-4235113 TTCAAGGATGTTCCCAGGCCAGG - Intronic
1024006138 7:45225949-45225971 TCCACGGATGCTGCCTGGGTGGG - Intergenic
1025603037 7:63017365-63017387 TATACTGATGGTCCCTGGCTTGG + Intergenic
1036782197 8:11657482-11657504 TATACTGATGGTCCCTGGCTTGG - Intergenic
1041054140 8:53965143-53965165 TCAACAGTTGTTCCCAGGCTGGG - Intergenic
1051516195 9:17933005-17933027 ACCATGCATGGTGCCAGGCTGGG - Intergenic
1055367149 9:75556784-75556806 ACCAAGGATGGTCCCAGTGTTGG + Intergenic
1057275921 9:93675900-93675922 GCCAGGGGTGGTCACAGGCTTGG + Intronic
1058758958 9:108111006-108111028 TCCACTGATGGTCAAGGGCTCGG - Intergenic
1061451605 9:130670033-130670055 TCCAGGGAGGGTCCCAGTGTGGG - Intronic
1185473321 X:398211-398233 TCCAAATAAGGTCCCAGGCTGGG + Intergenic
1188250055 X:27882106-27882128 TCCAGGGATGCTGCTAGGCTAGG + Intergenic
1190712072 X:53078474-53078496 CCCAAGGATGGGCCCAGGTTAGG + Exonic
1202391333 Y:24373361-24373383 TCCAGGGCTGCTCCAAGGCTGGG + Intergenic
1202479452 Y:25296756-25296778 TCCAGGGCTGCTCCAAGGCTGGG - Intergenic