ID: 1148936309

View in Genome Browser
Species Human (GRCh38)
Location 17:51166658-51166680
Sequence CGGGCTCCGCAGAGGGACGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148936297_1148936309 5 Left 1148936297 17:51166630-51166652 CCCTTGCAGCTTGCGCCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 129
1148936299_1148936309 4 Left 1148936299 17:51166631-51166653 CCTTGCAGCTTGCGCCCCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 129
1148936296_1148936309 30 Left 1148936296 17:51166605-51166627 CCGCGCGGCGTCGGAGCGGGAGA 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 129
1148936303_1148936309 -10 Left 1148936303 17:51166645-51166667 CCCCGCGGGCCTTCGGGCTCCGC 0: 1
1: 0
2: 3
3: 14
4: 139
Right 1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148936309 Original CRISPR CGGGCTCCGCAGAGGGACGC CGG Exonic
900227668 1:1540516-1540538 GGGGCGCCGGGGAGGGACGCGGG + Intergenic
901741754 1:11346333-11346355 TGGGCCAGGCAGAGGGACGCGGG - Intergenic
904206966 1:28861770-28861792 CAGGCTCCCTAGAGGGAAGCAGG - Intronic
904652287 1:32014390-32014412 CGGGCGACCCAGAGGGACACGGG - Intronic
905304262 1:37006706-37006728 CGGGCGCCGCAGAGTGAGGGAGG + Intronic
914361429 1:146939113-146939135 CGGGCTCCGCAGGGCTCCGCCGG + Intronic
914491176 1:148151597-148151619 CGGGCTCCGCAGGGCTCCGCCGG - Intronic
917894948 1:179478536-179478558 AGGGCACAGCAGAGGGACCCTGG + Intronic
923109584 1:230879981-230880003 GGAGGTCTGCAGAGGGACGCAGG - Intergenic
924715176 1:246566494-246566516 AGGGGTGCGCAGAGGGAGGCGGG + Exonic
1066460445 10:35608241-35608263 CAGGCCACGCGGAGGGACGCCGG + Exonic
1066488471 10:35871884-35871906 TGGGATCCCCAGAGGGACCCAGG + Intergenic
1067436824 10:46284552-46284574 CGGGCTCTCCAGAGGCGCGCAGG + Intergenic
1077402088 11:2363950-2363972 GGGGCACTGCAGAGGGACTCAGG + Intergenic
1081863939 11:46349327-46349349 CAGGCTCCGCAGGGGGAGGGAGG + Intronic
1085514628 11:77105152-77105174 CGGGCACAGCAGAGGGACTCAGG - Intronic
1090356920 11:126146608-126146630 CGGGCTCCCCAGAGGGGACCTGG - Intergenic
1090806933 11:130208704-130208726 AGGGCTCCGCAGAGGGCCTGGGG + Intronic
1091785770 12:3242588-3242610 TGGGCTCCGCAGAGGATAGCAGG - Intronic
1091807418 12:3366214-3366236 TGGGCACCGCAGCGGGGCGCGGG - Intergenic
1091986256 12:4911671-4911693 CGGCCTCCGCAGGCGGCCGCCGG - Exonic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1103451505 12:121032521-121032543 CGGGATCCCAAGTGGGACGCTGG - Intronic
1107086408 13:36431856-36431878 CTGGCTCGGGAGAGCGACGCGGG - Intronic
1118731361 14:68669350-68669372 CGTGCTCTGGAGAGGGAAGCAGG - Intronic
1122233340 14:100318326-100318348 CGGGCGCCGCAGAGGGCTTCGGG - Intergenic
1122693184 14:103541128-103541150 CGGGCCCTGCAGAGGAATGCTGG + Intergenic
1123004596 14:105315122-105315144 TGGGCTCCGCTGGGGGACCCGGG - Exonic
1123021222 14:105398763-105398785 CGGGGTCCGCGGAGGGACGGGGG - Intronic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1123987765 15:25659965-25659987 CGGGCTCTGCAGGGAGACTCCGG - Intergenic
1132111390 15:99104847-99104869 CGGGCTCAGCGAAGGGACGCCGG - Intronic
1132533622 16:466544-466566 CGGGCTCCTCCGAGGGCAGCAGG - Intronic
1136580021 16:31145801-31145823 CTGGCTACCCAGAGGGCCGCAGG - Exonic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1139599511 16:67978154-67978176 AGGGGTCCGCAGAGGGAGGCTGG - Intronic
1139614098 16:68078784-68078806 CTGGCTCCGCAGACAGACGATGG - Exonic
1140035660 16:71369461-71369483 AGGGCTCCACAGAGGGATGACGG + Intronic
1140224670 16:73067771-73067793 AGGGGTCTGCAGAGAGACGCTGG + Intergenic
1141783363 16:86180414-86180436 AGGGCTCCACCGGGGGACGCAGG + Intergenic
1143487130 17:7261327-7261349 CGGGCTCAGAGCAGGGACGCCGG - Intronic
1143639879 17:8189846-8189868 CGGGAGCCGCAGGGGGGCGCCGG - Exonic
1145012462 17:19377755-19377777 CGGGCTCCGCAGAGGAGCAGAGG + Exonic
1147028383 17:37609278-37609300 CGGGGTCCGCCGGGGGAGGCGGG - Exonic
1147971246 17:44219935-44219957 CGGGCTCCGCGGGGGGCAGCTGG + Intronic
1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG + Exonic
1149314029 17:55421967-55421989 CGGGCTCCGGGGCGGGGCGCAGG - Exonic
1152022732 17:77789315-77789337 CGGGCTCTGCAGAGGGAAGAAGG - Intergenic
1152396323 17:80035794-80035816 CGGCCCCCGCAGCGGGACCCGGG - Exonic
1152747499 17:82048222-82048244 CGGGCACCACAGTGGGACTCAGG - Exonic
1157099713 18:44718330-44718352 TGGGCTCTGAAGAGGGACCCTGG - Intronic
1157710316 18:49845732-49845754 CTGGCTCTGCAGGGGGATGCTGG + Intronic
1159511448 18:69401481-69401503 GGGGCTCCGCAGACGGACCTGGG + Intronic
1161076935 19:2290381-2290403 CGTGCTCCCCGGGGGGACGCTGG - Exonic
1161739594 19:6012583-6012605 CTGGCTCCGCGGAGGGTCACGGG + Intronic
1161894463 19:7069810-7069832 CCGGCTCCCGGGAGGGACGCAGG - Intronic
1162582187 19:11538287-11538309 CCGGCACAGCAGAGGGACTCGGG - Intergenic
1163424804 19:17235470-17235492 CACGCTCCGAAGAGGGCCGCGGG - Intronic
1166317942 19:41999055-41999077 CGGGCTCCGCTGGGGGGCCCCGG + Exonic
1166564443 19:43755017-43755039 CGGGTTCCGGAGCGGGAGGCGGG + Intergenic
1167955214 19:53058532-53058554 CGGGGTCTGCAGAGGGACCGCGG + Intergenic
1168153949 19:54463062-54463084 CTGGCTCGGCGGCGGGACGCGGG - Exonic
1168580819 19:57554347-57554369 CTGGCTCCTCATAGGGATGCTGG - Intronic
925609339 2:5691407-5691429 CGGGCCCCTCGCAGGGACGCCGG + Intergenic
932144601 2:69306753-69306775 GGGGCTCCGGAGGGGGAGGCAGG + Intergenic
932413346 2:71559955-71559977 CTGGCCCCGCAGAGGCAGGCAGG + Intronic
933985058 2:87584027-87584049 CCGGCTCTGCAGAAGCACGCTGG + Intergenic
934479495 2:94622272-94622294 TGGGCTCCCCAGAGGCAGGCGGG - Intergenic
935594285 2:104867491-104867513 CGGGCTCCGCAGACGTGCCCGGG + Intergenic
936308785 2:111366783-111366805 CCGGCTCTGCAGAAGCACGCTGG - Intergenic
938392431 2:130916283-130916305 CGGGCTCCGCAAGGGCGCGCAGG + Intronic
938919827 2:135985335-135985357 CGGGCTGCGCCGAGGGAGGGAGG - Intronic
946922852 2:224597357-224597379 CTGGCTCCTGAGAAGGACGCTGG + Intergenic
947846935 2:233251979-233252001 CGGGCCCCGCGGAGGCATGCGGG + Intronic
948672814 2:239579350-239579372 CGCCCTCTGCAGAGGGACGAGGG + Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
1170704355 20:18731928-18731950 TGGGCTCCACAGAGGGGCACTGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1171978245 20:31608774-31608796 CGGGCCTCGCAGAGGGAGGGGGG + Intergenic
1172628254 20:36360959-36360981 CGGGCTGCACAGAGAGACTCGGG + Intronic
1173633187 20:44531882-44531904 CGGGCTCCGCTGCGGGTTGCGGG + Intronic
1173662170 20:44742405-44742427 AAGGCCCCGCTGAGGGACGCGGG + Intergenic
1173862794 20:46295152-46295174 CGGCCTCTGCAGAGGGCAGCAGG - Intronic
1175108711 20:56631111-56631133 CGGGCTACGCAGAGGGCCCCGGG - Intronic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175424575 20:58855415-58855437 GGGGCTCCGCAGTGGGAGGAGGG + Intronic
1175443759 20:59007144-59007166 CGGGATCCGGAGCGGGACCCAGG - Exonic
1176131744 20:63499256-63499278 CGGGCTGCAAAGACGGACGCGGG + Exonic
1176240299 20:64072821-64072843 CGGGGTCCCCAGAGGCAGGCTGG - Intergenic
1178534986 21:33403630-33403652 GGGCCTCCGCGGCGGGACGCGGG + Intronic
1179561810 21:42219990-42220012 CGAGCTCCGGAGAGGGATGGCGG + Intronic
1179968297 21:44818952-44818974 CGGGCACTCCTGAGGGACGCAGG - Intergenic
1180179255 21:46110753-46110775 CTGGCTCCGCAGAGTGGGGCTGG - Intronic
1180990015 22:19930108-19930130 GGGGATCCGCAGAGGCACCCAGG - Intronic
1183546244 22:38455943-38455965 CGGCCTCCGCAGTGGGGCGCGGG - Intergenic
1184004768 22:41699907-41699929 CGGGCTCCACGGAGGCCCGCAGG - Intronic
1184662150 22:45970409-45970431 CGGGGTCTGCAGAGGTACACTGG + Intronic
949506925 3:4737337-4737359 CAGGCTCCCCAGAGAGATGCTGG - Intronic
950045799 3:9947864-9947886 TGGGCTCCGGAGGGGGAGGCTGG + Exonic
950897843 3:16469612-16469634 CGTGCTCCACAGAGGGAAGGGGG + Intronic
952816586 3:37452384-37452406 CCGGCTGCGCCGAGGGGCGCCGG + Exonic
952920834 3:38282740-38282762 CGGTCCCTGCAGAGGGAGGCTGG + Intronic
956229640 3:66998749-66998771 CGGGCTCCGCAGGAGCAGGCTGG + Intronic
960972524 3:123150023-123150045 TGGGCTCCTCAGAGGGAATCAGG + Intronic
964451282 3:156816090-156816112 CGCGCTTCGCAGAGGGAGGTGGG - Intergenic
968618191 4:1591793-1591815 GGGACTCCCCAGAGGGCCGCAGG + Intergenic
969683351 4:8655632-8655654 CGGCCTCTGCACAGGGAAGCAGG + Intergenic
975556857 4:75673529-75673551 CGTGCTCCGCAGAGGGACACGGG - Exonic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
986135073 5:4969353-4969375 AGGGGGCTGCAGAGGGACGCAGG - Intergenic
990449991 5:55924960-55924982 CTGGCTCCGCAGACGGAGGAAGG - Intergenic
991037006 5:62137433-62137455 CTGGCTCCGCAGAGAGAGCCAGG - Intergenic
998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG + Intronic
999188698 5:149731092-149731114 CGCGCACCGCAGGGGGACCCAGG - Intronic
1001534286 5:172487887-172487909 CACGCTCTGAAGAGGGACGCAGG - Intergenic
1015625998 6:135181477-135181499 GGGGCTCCGCCGAGAGCCGCGGG - Exonic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018679565 6:166252879-166252901 GGGGCTCCGCACTGGGAGGCTGG + Intergenic
1019611723 7:1940126-1940148 AGGCCGCCGCAGAGGGAAGCGGG + Intronic
1019689717 7:2403761-2403783 CGGGCCGCGCTGAGGGGCGCGGG + Intronic
1028860307 7:95641648-95641670 CTGGCTCCACAGAGAGATGCTGG - Intergenic
1029708282 7:102286712-102286734 CGGGCTCCGCGGATGGCCGGGGG + Intronic
1030267094 7:107631789-107631811 TGGACTCGGCAGAGGGAGGCAGG - Intergenic
1030303953 7:108001718-108001740 CGGGCTCTGCACAGGGCTGCGGG + Exonic
1039579211 8:38650523-38650545 CGGGCACCCCAGAGGGACGGAGG + Intergenic
1042563526 8:70091394-70091416 CAGGCTCCGGGGAGGGACACAGG - Intergenic
1049255425 8:141611219-141611241 CGAGCTCTGCAGAGGGTCCCGGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1053443534 9:38135020-38135042 GGGGCTCCGCAGAGGGATGGGGG + Intergenic
1059176798 9:112175339-112175361 CCGGCGCCGCCGAGGGAAGCGGG + Intronic
1059760199 9:117330375-117330397 GGGGCTTCGGAGAGGGACTCAGG - Intronic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1061577760 9:131518243-131518265 CGGGCTGCTCCGAGGGTCGCTGG - Intronic
1061837803 9:133341069-133341091 GGGGCTCTGCACAGGAACGCTGG + Exonic
1061865264 9:133488873-133488895 CGGGATGCGAAGAGGGACGTGGG - Intergenic
1061896006 9:133648051-133648073 AGGCCTCCACTGAGGGACGCGGG - Intronic
1062045540 9:134422834-134422856 GGGGCTCTGGAGAGGGAGGCTGG + Intronic
1062355425 9:136159852-136159874 CAGGTTCCGCTGAGGGACCCTGG - Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1192189311 X:68981091-68981113 CGGGCTCCTGAGTGGGAAGCAGG - Intergenic
1200112250 X:153746887-153746909 GGGGCTCCTCAGTGGGACGTGGG + Intergenic