ID: 1148943457

View in Genome Browser
Species Human (GRCh38)
Location 17:51236604-51236626
Sequence AACTGTGCCACATGCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148943457_1148943465 7 Left 1148943457 17:51236604-51236626 CCCTCCAAGCATGTGGCACAGTT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1148943465 17:51236634-51236656 GTGGCACAAGGCCCGAGGCAGGG 0: 1
1: 0
2: 2
3: 10
4: 149
1148943457_1148943462 -5 Left 1148943457 17:51236604-51236626 CCCTCCAAGCATGTGGCACAGTT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1148943462 17:51236622-51236644 CAGTTCAATGGTGTGGCACAAGG 0: 1
1: 0
2: 1
3: 12
4: 148
1148943457_1148943464 6 Left 1148943457 17:51236604-51236626 CCCTCCAAGCATGTGGCACAGTT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1148943464 17:51236633-51236655 TGTGGCACAAGGCCCGAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 144
1148943457_1148943469 29 Left 1148943457 17:51236604-51236626 CCCTCCAAGCATGTGGCACAGTT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1148943469 17:51236656-51236678 GAGGCCTCTGCTGCCCTCACAGG 0: 1
1: 0
2: 2
3: 47
4: 359
1148943457_1148943466 10 Left 1148943457 17:51236604-51236626 CCCTCCAAGCATGTGGCACAGTT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1148943466 17:51236637-51236659 GCACAAGGCCCGAGGCAGGGAGG 0: 1
1: 0
2: 0
3: 27
4: 282
1148943457_1148943463 2 Left 1148943457 17:51236604-51236626 CCCTCCAAGCATGTGGCACAGTT 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1148943463 17:51236629-51236651 ATGGTGTGGCACAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148943457 Original CRISPR AACTGTGCCACATGCTTGGA GGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901227611 1:7623310-7623332 AACTGTGGCACTTGCTTTGCAGG - Intronic
903585032 1:24408093-24408115 AAGTGTGCCACATCCTTTGCAGG - Intronic
908655699 1:66385858-66385880 AACTCAACCACATGCTGGGAGGG + Intergenic
911130188 1:94379847-94379869 AACTGTGCCAGGTACTGGGAAGG + Intergenic
918106660 1:181421308-181421330 AACTTTGCAACAGGCTTGCAAGG - Intronic
922041827 1:221904410-221904432 AACTGTGCCACCTGCTAGCAGGG - Intergenic
923409190 1:233690608-233690630 AACTGTGCCAGGTGCTCAGAGGG + Intergenic
924071591 1:240285703-240285725 AACTGTGTCACATGCTGCCAAGG + Intronic
1063219014 10:3949066-3949088 ACCTGTGTAAAATGCTTGGAGGG + Intergenic
1066543595 10:36475495-36475517 AACAGTGTCACATCCCTGGAGGG + Intergenic
1068065928 10:52131330-52131352 AATGGTGATACATGCTTGGATGG + Intronic
1069647938 10:70018218-70018240 AACTGTGGCACATCCTTACAAGG + Intergenic
1069750884 10:70744268-70744290 AACTGTGCCACAGTCTGGGGTGG + Intronic
1072307732 10:94123348-94123370 AACTGTGCCAGAGGCTTCTATGG - Intronic
1073308901 10:102525442-102525464 CACTGTGCCAGTTGCTGGGATGG - Intronic
1073341127 10:102745035-102745057 AGCTTTGCCACATGCAAGGAAGG - Intronic
1074298601 10:112213135-112213157 AACTGTTTCACATGCTCGGTTGG - Intronic
1074792745 10:116907688-116907710 AACTGTGCCACATACTTGGGAGG + Intronic
1075721250 10:124588863-124588885 CACTGTGCAACATGTGTGGAGGG - Intronic
1078423594 11:11231782-11231804 CACTGAACCAGATGCTTGGAAGG + Intergenic
1086439562 11:86814670-86814692 CACAGTGCCCCATGCTTGCATGG - Intronic
1087691473 11:101325653-101325675 AACTGTAGCACAGTCTTGGAGGG - Intergenic
1089093349 11:115897150-115897172 AACTCTTCCTCATGCTAGGAGGG - Intergenic
1089847247 11:121468028-121468050 ACCTGTGCCACATATTTGGCTGG - Intronic
1092765371 12:11848206-11848228 AACTATGCCACAGACTTGGCAGG - Intronic
1095908751 12:47404713-47404735 AACTGTTCCACATGCATGGATGG + Intergenic
1095910293 12:47419125-47419147 AAGTGTGCCACATGATTACATGG + Intergenic
1098454649 12:70658481-70658503 AACTGTGCCCCATGAATGGCAGG + Intronic
1099238333 12:80109714-80109736 AAATGTACCACATGCCTAGAAGG + Intergenic
1100596686 12:96078170-96078192 AACTGTGCTATAGGCTGGGACGG + Intergenic
1104007594 12:124904899-124904921 CACTGTCCCACGTGCTTGCAGGG + Intergenic
1104540921 12:129663855-129663877 AAATGTGCCACATGATTACATGG - Intronic
1105515718 13:21089044-21089066 AACTGTTCCACACTCTTGGTGGG + Intergenic
1105700017 13:22928582-22928604 AACAATGCCACATTCCTGGAAGG - Intergenic
1107054648 13:36089975-36089997 AAGTGTGCCACATGCATTGTGGG + Intronic
1113007844 13:105727434-105727456 GACTCTCCCACATGCTTTGAAGG + Intergenic
1113332673 13:109345700-109345722 AACTCTGTCACATGCTTTGATGG + Intergenic
1115268633 14:31527310-31527332 AACTGGGCCAGCAGCTTGGAGGG - Intronic
1118833612 14:69459054-69459076 ATCTATGCCACATGCGTTGATGG + Exonic
1119115250 14:72014397-72014419 GAATGTGCCACATGCTTTAAAGG - Intronic
1119708055 14:76799116-76799138 AACTGTGACACTAGCTTGAATGG - Intronic
1121452924 14:94020847-94020869 AACTGTGAGAAATGCTAGGATGG + Intergenic
1124233086 15:27963475-27963497 AACTTTCCCAAATACTTGGAAGG + Intronic
1124400175 15:29341096-29341118 AACTGTGCCACATACTCCCAAGG + Intronic
1125325316 15:38530583-38530605 AACTGTGACATATACTTGTAGGG + Intronic
1126917030 15:53477349-53477371 AATTGTGACAGCTGCTTGGACGG + Intergenic
1127026242 15:54810203-54810225 CACTGTGCCATATGCTTTGCAGG - Intergenic
1132163344 15:99563548-99563570 ACGTGTGCCACTGGCTTGGAGGG - Intergenic
1133607268 16:7400096-7400118 AACTGTGCCACTTTCTTAGTTGG - Intronic
1135547396 16:23375350-23375372 ATCTGTGTCAGGTGCTTGGACGG + Intronic
1138683134 16:58701331-58701353 CACTGTTCCACATGACTGGAAGG - Intergenic
1139571370 16:67814741-67814763 CACTGTGCTACCTGCTGGGACGG + Intronic
1141024202 16:80528594-80528616 TGCTGAGGCACATGCTTGGAAGG - Intergenic
1148326366 17:46785629-46785651 AGCTGTGCCACCTCCTCGGAAGG - Intronic
1148779841 17:50115201-50115223 AGCTGGGCCACCTGCTTGGTAGG - Intronic
1148943457 17:51236604-51236626 AACTGTGCCACATGCTTGGAGGG - Intronic
1150064109 17:62094443-62094465 AACTGTGCCACTTTCTTTGCAGG + Intergenic
1153928220 18:9854459-9854481 AACTGTGGAAGATGCTTGGCAGG - Intronic
1154261104 18:12833578-12833600 CACTTTGCCTTATGCTTGGAGGG - Intronic
1154497509 18:14973223-14973245 AACTGTGCCCAATGCTGGCAAGG + Intergenic
1157372963 18:47134779-47134801 AACTGTGCCAAATGTTTTTATGG + Intronic
1158807826 18:60996639-60996661 AACTGTGAGACTTGTTTGGAGGG + Intergenic
1159908565 18:74121474-74121496 AGATGTTCCACATTCTTGGATGG + Intronic
1161738133 19:6004253-6004275 AACTTTGCCAAGAGCTTGGAAGG - Exonic
1162114722 19:8421937-8421959 ACCTGTGCCACATACTGGGGCGG - Exonic
1163976657 19:20859110-20859132 CACTGGCCCACAGGCTTGGAAGG - Intronic
1165829300 19:38722610-38722632 AACTGTGCCAAATGCTGTGATGG - Intronic
925483026 2:4297641-4297663 CACTTGTCCACATGCTTGGAGGG + Intergenic
926644306 2:15272820-15272842 AACTGTGCCACATATTTTCAGGG + Intronic
930296890 2:49565811-49565833 AAATGTGTCACATTCCTGGAGGG + Intergenic
931184650 2:59938249-59938271 GACTGTGCTACATGCCTGGCTGG - Intergenic
932437600 2:71711846-71711868 AACTGTGAAGCATCCTTGGACGG - Intergenic
932576851 2:72967259-72967281 AACTGTGCTAGATGCTGGGCAGG + Intronic
933280111 2:80323506-80323528 CACTGTCCTAGATGCTTGGAAGG + Intronic
933935751 2:87202477-87202499 AACAATGACACATGCTGGGAAGG - Intergenic
936357397 2:111763348-111763370 AACAATGACACATGCTGGGAAGG + Intergenic
937940720 2:127283675-127283697 AACTGTCACACATTCCTGGAGGG - Intronic
945907778 2:215614401-215614423 AACTGGGCTACGTGCTTGAATGG - Intergenic
946074842 2:217065185-217065207 AGCTGTGTCGCATGCTTGCAGGG - Intergenic
946656166 2:221950389-221950411 CACTCTGCCACTTGCTAGGAAGG - Intergenic
946708810 2:222485810-222485832 AAGTGTTCCCCATGCTGGGAAGG + Intronic
948468040 2:238161527-238161549 AAGTGTCCCACCTGCTTGGTAGG + Intronic
948767653 2:240231760-240231782 CACTGTGCCACTTGCTCAGATGG + Intergenic
1170053917 20:12178051-12178073 TTCAGTGCCACATGGTTGGATGG - Intergenic
1170557936 20:17530801-17530823 AAATGTGCCACCTGCGTGCAGGG + Intronic
1170565229 20:17597502-17597524 AATTTTGCTACATGCATGGATGG + Intronic
1171385351 20:24766040-24766062 ACCTGTGCCAGATGCTAGGTTGG + Intergenic
1181093216 22:20488514-20488536 CACTGTGCCAAGTGCTGGGATGG + Intronic
1182676116 22:32041252-32041274 CATTGTGACACATGCTTTGAAGG - Intergenic
1184047223 22:41978963-41978985 CACTGTGCCACAAGCTTTGCTGG - Intronic
1184325235 22:43778124-43778146 CACTGTGCCACAGGGCTGGAAGG - Intronic
952264352 3:31770916-31770938 AACTGTGCCACTTCCTAGAATGG - Intronic
953304898 3:41819564-41819586 AGCTGTGCCATTTGCTTGAATGG - Intronic
954044367 3:47916775-47916797 AACAGTGTCACATCCTTGGCTGG + Exonic
955555129 3:60128624-60128646 AACTGGGCCACATGCCCAGAAGG + Intronic
956325484 3:68047934-68047956 AAGTTGGCCACATGCTTGTAAGG + Intronic
960366748 3:116782096-116782118 GGCTGTTCCACATGCTTGGGAGG - Intronic
964661910 3:159129438-159129460 ACTTGTGCCACAAGCTTAGAAGG - Intronic
971355544 4:25891510-25891532 ATATGTGCCACATGCATGCATGG - Intronic
976621945 4:87137262-87137284 AAATGTGAAACATGCTTGGTAGG - Exonic
977340164 4:95747928-95747950 AACTGGTCTACATGCTTGAAGGG - Intergenic
978665204 4:111173817-111173839 AGCAGTACCACATTCTTGGAAGG + Intergenic
981043259 4:140242614-140242636 ATATGTTCCACTTGCTTGGAAGG + Intergenic
981307684 4:143264193-143264215 AACTCTGAAACATGGTTGGAAGG + Intergenic
982278656 4:153662486-153662508 AGCTGAGCCACATGCTTTGAAGG + Intergenic
982412845 4:155098625-155098647 ACCTGTGCCACATGCATGCAGGG - Intergenic
982445894 4:155490394-155490416 CACTGTGCCATATGCTAGGATGG + Intergenic
988561240 5:32283508-32283530 ACCTGTGCCACATACTAGCAGGG - Intronic
992563619 5:77976186-77976208 AACTGTTCCAAATGCCTGGAAGG + Intergenic
996693619 5:126368263-126368285 AGCTGTGGCACAGGCTAGGAGGG + Intronic
998405415 5:141871612-141871634 AATTGTGCTAAATGCTTTGAAGG - Intronic
998880719 5:146642158-146642180 AGCTGAGCTCCATGCTTGGAAGG + Intronic
999652257 5:153779067-153779089 AACTGTGCCATAAGTTTAGAGGG + Intronic
999730113 5:154470614-154470636 AAATGAGGGACATGCTTGGATGG + Intergenic
1001085323 5:168696333-168696355 AACAATGCCACCTGCGTGGACGG - Exonic
1001365973 5:171140313-171140335 TACTGTGCCAGATGCTGGAATGG - Intronic
1002473011 5:179448472-179448494 AACTGTGCCGCCTGGATGGAGGG + Intergenic
1002481213 5:179502182-179502204 AACTGTGCCGCCTGGATGGAGGG - Intergenic
1002593581 5:180307183-180307205 AACTATGCCACCTGCCTGGAAGG - Exonic
1003709272 6:8570798-8570820 AACTGTGGCAGATGCATGGATGG + Intergenic
1006192287 6:32217058-32217080 TGCTGTGCCACAGGCTTTGAAGG - Exonic
1006392742 6:33768351-33768373 AACTGGGCCACACTCTTGGCAGG + Intergenic
1007076072 6:39066926-39066948 GACTGTGCCAGGTGCTTTGAAGG - Intronic
1007650650 6:43418584-43418606 AACTGTCCCAGATACTTGGGAGG + Intergenic
1007655966 6:43451116-43451138 AACGGTGCCACCTGCCTTGACGG - Exonic
1008207569 6:48681850-48681872 AATTGTGGTACATTCTTGGAGGG + Intergenic
1008843710 6:55936329-55936351 CTCTGTGCCACATCCTGGGATGG + Intergenic
1013724789 6:113080994-113081016 AGCAGTGCCACATGCTTGGTAGG - Intergenic
1016437282 6:144049824-144049846 AACTGTGTGACATACTTAGAAGG + Intronic
1018222909 6:161599205-161599227 CAATCTGCCACAAGCTTGGATGG - Intronic
1018395421 6:163374623-163374645 ACCTGTGACACCTGCTGGGAAGG - Intergenic
1022677717 7:32515174-32515196 ACCTGTGACACATCCTTAGAAGG - Intronic
1023998236 7:45175008-45175030 ACCTGTGCTACATGCAGGGATGG + Intronic
1024727099 7:52210548-52210570 AAATATTCCACATTCTTGGAAGG - Intergenic
1029684015 7:102133055-102133077 AACTTTAGCAGATGCTTGGAGGG - Intronic
1030847350 7:114436286-114436308 AACTGTGACAGATGCTTCAAAGG - Intronic
1030847376 7:114436710-114436732 AACTGTGACAGATGCTTCAAAGG + Intronic
1031391439 7:121219660-121219682 AACTGTGTCACATTCTATGATGG + Intronic
1032703536 7:134403089-134403111 AACTGTGTTAAATGCTTTGATGG + Intergenic
1033135450 7:138780411-138780433 AACTGGGCCACATAGCTGGAGGG - Intronic
1034984160 7:155497148-155497170 AACTGTTCCACAGTCCTGGAGGG + Intronic
1035626746 8:1076633-1076655 AACTCTGCCAACTGCTGGGAAGG - Intergenic
1035998633 8:4577362-4577384 AAATGTGCCACAGGTTTAGAAGG - Intronic
1037287911 8:17320743-17320765 AAGTGAGCCTGATGCTTGGAGGG - Intronic
1038353640 8:26806069-26806091 AAAGCTGCCACATGCCTGGAAGG - Intronic
1038353728 8:26806723-26806745 AAAGCTGCCACATGCCTGGAAGG + Intronic
1039269876 8:35869040-35869062 AACTTTGCCATTTGCTTTGAGGG - Intergenic
1043473613 8:80584925-80584947 AATCCTCCCACATGCTTGGAAGG - Intergenic
1044087625 8:87959762-87959784 AACTGTGCCTCATCCCTGAAGGG - Intergenic
1045828136 8:106425697-106425719 AACTGTGCCAAAGACTGGGAAGG + Intronic
1046793612 8:118347256-118347278 AATTTTGGCACATGCTAGGAAGG - Intronic
1051866162 9:21685213-21685235 AACTGAGTCACAGGCTAGGAAGG + Intergenic
1056883760 9:90420365-90420387 AGCTGTGGCACATAGTTGGATGG - Intergenic
1060281509 9:122218768-122218790 GACTGGGACACATGCCTGGATGG - Intronic
1062426624 9:136509039-136509061 AACGGTGGCACCTGCGTGGACGG - Exonic
1187960044 X:24559672-24559694 AAATATGCCCCAAGCTTGGAGGG - Intronic
1192026013 X:67452556-67452578 AATTGTGCCAGATACTTGGGAGG + Intergenic
1192709219 X:73562761-73562783 AACTTTGCCACAATCTTGGGAGG - Intergenic
1195555558 X:106218140-106218162 AAGTGTCCCTGATGCTTGGATGG - Intergenic
1195994018 X:110713195-110713217 AACTGTGCCACATGCCACAAAGG - Intronic
1197721014 X:129744634-129744656 AATTTTCCCACATGCTGGGAAGG + Intronic
1198363323 X:135916936-135916958 AATGGTGTCACATGGTTGGAGGG + Intergenic
1198484210 X:137070179-137070201 ATATGTGCCACATGAATGGATGG + Intergenic
1201987729 Y:19987784-19987806 AGCTGTGCCACCTGCTTTGCTGG + Intergenic