ID: 1148945485

View in Genome Browser
Species Human (GRCh38)
Location 17:51259483-51259505
Sequence CCACCCTGGGTGGCTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148945470_1148945485 15 Left 1148945470 17:51259445-51259467 CCCCCTCCCCGCCAAGAAGAGAG 0: 1
1: 1
2: 3
3: 40
4: 562
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945477_1148945485 7 Left 1148945477 17:51259453-51259475 CCGCCAAGAAGAGAGGACTACTC 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945478_1148945485 4 Left 1148945478 17:51259456-51259478 CCAAGAAGAGAGGACTACTCCAC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945474_1148945485 12 Left 1148945474 17:51259448-51259470 CCTCCCCGCCAAGAAGAGAGGAC 0: 1
1: 0
2: 3
3: 8
4: 160
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945475_1148945485 9 Left 1148945475 17:51259451-51259473 CCCCGCCAAGAAGAGAGGACTAC 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945473_1148945485 13 Left 1148945473 17:51259447-51259469 CCCTCCCCGCCAAGAAGAGAGGA 0: 1
1: 0
2: 3
3: 11
4: 201
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945476_1148945485 8 Left 1148945476 17:51259452-51259474 CCCGCCAAGAAGAGAGGACTACT 0: 1
1: 0
2: 3
3: 20
4: 457
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1148945471_1148945485 14 Left 1148945471 17:51259446-51259468 CCCCTCCCCGCCAAGAAGAGAGG 0: 1
1: 0
2: 2
3: 28
4: 288
Right 1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG 0: 1
1: 0
2: 1
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148945485 Original CRISPR CCACCCTGGGTGGCTAAAAA AGG Intronic
901629456 1:10641145-10641167 CCACCCGGAGTGGACAAAAACGG + Intronic
901720029 1:11189632-11189654 CCACGCTGGGTGGCTGACAAAGG - Exonic
903446011 1:23423675-23423697 TCACCCTGGGAGGGAAAAAAAGG - Intronic
905898366 1:41563945-41563967 CCACCTTGGGAGGCTGAAGAGGG + Intronic
907277636 1:53326172-53326194 CTAACCAGGGTGGCTCAAAAAGG + Intronic
907531454 1:55102197-55102219 CCAATCTGGATGGCAAAAAAAGG + Intronic
909517819 1:76532210-76532232 CTTCCCTGGGTGGGTGAAAATGG - Intronic
913228316 1:116720107-116720129 CCCCCCTGGTTGGTGAAAAAAGG + Intergenic
915274306 1:154777423-154777445 CCATTCTGGGTGGTTAACAAGGG - Intronic
915678906 1:157560662-157560684 CCAGCCTGGGTGACAAAAAGAGG - Intergenic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
923736060 1:236608839-236608861 ACGCCCTGGGAGGCTGAAAATGG + Intergenic
923842030 1:237683457-237683479 CCACCTTGGGTGGATATAGAGGG + Intronic
1064354032 10:14602010-14602032 CTTCCTTGGGTGGTTAAAAATGG - Intronic
1064622342 10:17229009-17229031 TCACCCTGGGGTGCTGAAAAAGG - Intronic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067158972 10:43806871-43806893 GCACTTTGGGTGGCTAAAGAGGG - Intergenic
1068548833 10:58384209-58384231 CAACCCTGGGAGTCTATAAAAGG + Intergenic
1069235389 10:66065131-66065153 TTACCCTGGGTGGCCAAAAAAGG + Intronic
1073948949 10:108784862-108784884 CCACCCTGGGTCACAACAAAAGG + Intergenic
1076802466 10:132836910-132836932 CAAGCCTGTGTGGCGAAAAACGG + Exonic
1077406874 11:2386676-2386698 CCACCCTGGGTGGAAAAATGGGG - Intronic
1077607518 11:3622078-3622100 CCATCCTGCGTGGCTTATAAGGG - Intergenic
1078697244 11:13646796-13646818 CCACCTTGCCTGGCTGAAAAAGG + Intergenic
1079119061 11:17666049-17666071 CCACTCTGTGTGGCTAGAAAAGG + Intergenic
1079545896 11:21631585-21631607 TCATCCTGGGTGGCAAAAAAAGG - Intergenic
1081627650 11:44665158-44665180 CCAGCCTGGGTGACAAAAAAAGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082704925 11:56481875-56481897 CCAGCCTGGGTGGCAAAGAGAGG + Intergenic
1083573729 11:63774167-63774189 GCACTTTGGGAGGCTAAAAAGGG + Intergenic
1083609023 11:63996386-63996408 CCACCCTGGGTCCCTGAAACAGG - Intronic
1084701676 11:70790321-70790343 CCACCCAGGGTGCATAAAGAGGG + Intronic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1087282554 11:96228070-96228092 CCAGCCTGGGGGGAGAAAAAGGG + Intronic
1088460730 11:110080006-110080028 GCACCCTGGGTGGCTGAGATGGG + Intergenic
1089594179 11:119566393-119566415 CCACCCAGTGTTGCTAAAATTGG - Intergenic
1090298450 11:125611771-125611793 TGACCCTGGGTGTCTTAAAACGG + Intronic
1092977490 12:13759411-13759433 CCACTCTGGCTGGCTACAACAGG - Intronic
1093954476 12:25200673-25200695 AGACCCTGGATGTCTAAAAATGG - Intronic
1096586852 12:52628406-52628428 AGACCCTGGGTGGCCACAAAAGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1100685199 12:96979863-96979885 AAACACTGGGTGGCAAAAAACGG + Intergenic
1101869376 12:108550816-108550838 CCAGCCTGGGTGACAAAACAAGG + Intronic
1103883408 12:124183672-124183694 CCACGCTGGGTAGCAAATAATGG + Intronic
1106922715 13:34580774-34580796 ATACACTGGGTGGTTAAAAATGG + Intergenic
1107437105 13:40389823-40389845 CCAGCCTGGGTGGTTCAAACTGG + Intergenic
1107734715 13:43386593-43386615 CAACAATGGGTGGCTAAAAGTGG - Intronic
1107867040 13:44713138-44713160 CCAGCCTGGGTGACAGAAAAAGG + Intergenic
1107877376 13:44802665-44802687 ACACACTGAGTGGCTTAAAAAGG - Intergenic
1109928764 13:69184569-69184591 CCAACCTGGCTGTCTAAAAATGG - Intergenic
1111700124 13:91676315-91676337 CCACCTTGGGAGGCTGAGAAGGG - Intronic
1112011080 13:95294412-95294434 CCACCCTAGATGGCCCAAAAGGG - Intronic
1112205586 13:97320624-97320646 CCACCCTGCGTGGCCGAAGATGG - Intronic
1114544664 14:23490049-23490071 CCAGCCTGGGTGGCTAAATAGGG + Intronic
1115692460 14:35858969-35858991 CCAGCCTGGGTGACTAAGCAAGG - Intronic
1117288072 14:54306812-54306834 CCTGCCTGGGTGGGTAAGAAAGG - Intergenic
1118198745 14:63652563-63652585 CCACCTTGGGTGGCCAAAGAGGG - Intergenic
1119828057 14:77674571-77674593 CCAGCCTGGGTGACGAAATAAGG - Intronic
1120765022 14:88321087-88321109 ACAGCCTGGGTGTTTAAAAAAGG + Intronic
1122413827 14:101539177-101539199 CCTCCCTCAGTGGCTTAAAAAGG + Intergenic
1124609235 15:31197010-31197032 CCACTCTGGGAGGCTGAAGAGGG - Intergenic
1125086689 15:35738600-35738622 CCAGCCTGGGTGACAAAAAAAGG + Intergenic
1126544056 15:49853375-49853397 TCACCCTGGGTGGCTCAAAGAGG - Intergenic
1127777203 15:62273623-62273645 GGAGCTTGGGTGGCTAAAAAAGG + Intergenic
1128897700 15:71390887-71390909 CCAGCCTGGGTGACTGAACAAGG - Intronic
1128919506 15:71597754-71597776 CCACCCTAGGAGGCCAAAGAGGG - Intronic
1130314567 15:82784272-82784294 CCAACCTGGGTGGCAAAATGAGG - Intronic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1132412984 15:101599084-101599106 CCACCCAGGATGGCTATACATGG - Intergenic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135876032 16:26200840-26200862 ACAGCCTGGGTGGCTCAAACAGG + Intergenic
1135940041 16:26814672-26814694 CCACACTGGCAGGCTAAACATGG - Intergenic
1136995789 16:35187394-35187416 CCACCCTGGGAGGCCAAGGAGGG + Intergenic
1137497037 16:48978484-48978506 CCACTCTGGGAGGCCAAAAGGGG - Intergenic
1138363365 16:56451643-56451665 CCAGCCCGGGTGGGAAAAAAGGG + Exonic
1139708345 16:68757820-68757842 CCAGCCTGGGTGACAGAAAAAGG - Intronic
1141595572 16:85095011-85095033 CCTCCCTGTGTGGCTAAGAGGGG - Intergenic
1142075213 16:88114010-88114032 GCACCATGGGTGGCTAAGGAAGG + Intronic
1143605893 17:7985473-7985495 CAGCCCTGGGGGGCTACAAATGG + Intergenic
1145280157 17:21462252-21462274 TCACCCTGGGTGGCTGAAGATGG - Intergenic
1145397730 17:22508233-22508255 TCACCCTGGGTGGCTGAAGATGG + Intergenic
1147666592 17:42152747-42152769 CCAGCCTGGGTGACAAAACAAGG + Intronic
1148945485 17:51259483-51259505 CCACCCTGGGTGGCTAAAAAAGG + Intronic
1149084206 17:52694731-52694753 CCAACATGGGTGGCTGACAAAGG + Intergenic
1150485872 17:65543373-65543395 TCACCTTGGGTAGCTGAAAACGG + Intronic
1151433907 17:74082406-74082428 CCACTCTGAGTGTCTAAAAGGGG + Intergenic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1155159885 18:23186822-23186844 CCACCCTGGATGGGTAACATGGG + Intronic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1159150452 18:64516827-64516849 ACGCTCTGGGTGGCCAAAAAAGG - Intergenic
1162373490 19:10292272-10292294 TCACCCTGGGGGGCGAAAACCGG + Exonic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163748264 19:19060628-19060650 CCAGCCTGGGTGACAGAAAAGGG - Intergenic
1167675523 19:50882369-50882391 CCACCCTGGGAGGCTCCAGAGGG + Intergenic
1168364651 19:55775690-55775712 CCAGCCTGGGTGATTAAAAAAGG + Intergenic
927889392 2:26738840-26738862 CCACCCTGGGGGGCTAGGGAAGG - Intergenic
928434908 2:31248669-31248691 CAAGCCTGGCTGGCTTAAAATGG - Intronic
928987287 2:37194201-37194223 CCACCCTAGGTGACAGAAAAAGG - Intronic
929793544 2:45041109-45041131 ACATACTGGATGGCTAAAAAGGG - Intergenic
930005491 2:46892834-46892856 CCCCCCTGGGTGGCTAGGGAAGG - Intergenic
930021334 2:47003842-47003864 CCACCCTGGGTGGCCAGAGCTGG + Intronic
932143684 2:69300622-69300644 CCACCCTGTCTGACTTAAAATGG - Intergenic
935112143 2:100104236-100104258 CCACCCGGGGAGGCAGAAAAGGG + Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
936122832 2:109760915-109760937 CCACCCGGGGAGGCAGAAAAGGG - Intergenic
936221857 2:110610549-110610571 CCACCCGGGGAGGCAGAAAAGGG + Intergenic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
944278862 2:197871508-197871530 ACACCCTTGTTGGCTTAAAACGG + Intronic
948429566 2:237911233-237911255 CCAGGCTGGGTGGCCAAATAAGG - Intronic
1172204335 20:33152008-33152030 ACACTTTGGGAGGCTAAAAAGGG + Intergenic
1172752883 20:37263357-37263379 CCAACCTGGGTGGCAAAGATAGG - Intergenic
1173491242 20:43484200-43484222 GCACCCAGGATGGCTAAAGAGGG + Intergenic
1179287260 21:39988317-39988339 ACACACTGGGTAGCTTAAAATGG + Intergenic
1184030912 22:41894097-41894119 CCACCCCTGCTGGCTAAACATGG + Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
953217172 3:40930468-40930490 CCAGCCAGGGTGGCTAAGAGAGG + Intergenic
954109613 3:48426759-48426781 CCCCCTTGGGTGGCTAACAGAGG - Intronic
954602295 3:51878874-51878896 CCACTTCGGGTGGCAAAAAAGGG + Intergenic
955984107 3:64555472-64555494 CCACCCTGGGTGTCCTAACAGGG - Intronic
956527297 3:70178969-70178991 CCAGCCTGGGTGGCAAAGCAAGG + Intergenic
957238599 3:77627529-77627551 GCACTCTGGGAGGCTAAAATGGG - Intronic
958953343 3:100439969-100439991 ACACACTGGGTGGCTTAAACAGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
963232957 3:142927344-142927366 ACAGACTGGGTGGCTAAAAATGG + Intergenic
963991492 3:151661511-151661533 CCAGCCTGGGTGGCAGAGAAAGG - Intergenic
965029017 3:163339416-163339438 CCAGCCTGGGTGGCAAAGCAAGG + Intergenic
965207604 3:165742329-165742351 CCACCCTGGGAAGCTCCAAAAGG + Intergenic
965578855 3:170245982-170246004 CCAGCCTGGGTGACAAAGAAAGG - Intronic
968823369 4:2874184-2874206 CCAGCCTGGGTGGCAGAATAAGG + Intronic
974991785 4:69101470-69101492 CAACACTGGGTGGATAAATAAGG + Intronic
977338000 4:95721992-95722014 CCACCCTGGTTAGCTGAAAGGGG + Intergenic
979220084 4:118212508-118212530 CCAGCCTGGGTGGCAAAGCAAGG + Intronic
979320408 4:119316649-119316671 CCACCCTGCTTGGCCAAAAGAGG - Intergenic
985957932 5:3278156-3278178 CCCCCCTGGGAGGATAAAATGGG + Intergenic
986328807 5:6702592-6702614 CCAGCCTGGGTGCCCAAACACGG + Intergenic
992403830 5:76437079-76437101 CCAGCCTGGGTGGCAGAACAAGG - Intronic
995026888 5:107434140-107434162 CAAACTTGGGTGGCTGAAAAAGG + Intronic
996073478 5:119161544-119161566 CCAACCTGGGAGGCCAAACAGGG - Intronic
996626206 5:125573072-125573094 GCAATCTGGCTGGCTAAAAAGGG + Intergenic
997169798 5:131705442-131705464 CCAGCCTGGGCGACTCAAAAGGG + Intronic
999748897 5:154611574-154611596 CCTCCCTTGGTGGCTTCAAAAGG - Intergenic
1000100953 5:158015715-158015737 CCAACCTGGGTGTCTATCAATGG - Intergenic
1001452032 5:171834095-171834117 CCACCCAGAGAGGTTAAAAAAGG + Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004275499 6:14232131-14232153 CCAACTTGGGTGGTTAGAAAAGG + Intergenic
1006069952 6:31491019-31491041 ACACACTGGGTGGTTACAAAGGG - Intergenic
1008114393 6:47531001-47531023 GCACCCTGGGAGGCCAAGAAGGG + Intronic
1011286916 6:85734405-85734427 CCAGCCTGGGTGGCTAAGCAAGG + Intergenic
1021120004 7:16788660-16788682 CCACCCTGGGTGACAAAGAGAGG - Intergenic
1023834747 7:44061516-44061538 CCACCCTGGGTATTCAAAAACGG + Exonic
1025771290 7:64509877-64509899 CCACCCTGGGTCACACAAAAGGG + Intergenic
1025773963 7:64541806-64541828 CCTGCCTGCGTGGCTATAAATGG - Intronic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027428635 7:78086880-78086902 GCACTTTGGGAGGCTAAAAATGG - Intronic
1030909485 7:115229030-115229052 ACACACTGGGTGGGTAATAATGG + Intergenic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1034631805 7:152536874-152536896 GCACTCTGGGTGGCTGAAAGAGG + Intergenic
1035302422 7:157906253-157906275 CCACCCTGGGATGCCCAAAAAGG - Intronic
1041226263 8:55701582-55701604 CCAGCCTGGGTGACAAAAGAAGG + Intronic
1048335501 8:133499321-133499343 CCACACTGAGTGGCTTGAAAGGG - Intronic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189911647 X:45816098-45816120 CCACCCTGGGTGACAGAGAAAGG + Intergenic
1197226608 X:123961307-123961329 CCCCCATGGGTGGCCCAAAATGG + Intronic
1197391971 X:125878362-125878384 CCAGCTGGGGTGGCTAAATAAGG - Intergenic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1200064629 X:153498540-153498562 CCACCCTGGCTGGCTGAAGGAGG + Intronic