ID: 1148949501

View in Genome Browser
Species Human (GRCh38)
Location 17:51298117-51298139
Sequence AAAGCATGGAGGATCGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148949501_1148949507 -5 Left 1148949501 17:51298117-51298139 CCTGAATCGATCCTCCATGCTTT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1148949507 17:51298135-51298157 GCTTTAGGGGATCAGCTAACAGG No data
1148949501_1148949510 24 Left 1148949501 17:51298117-51298139 CCTGAATCGATCCTCCATGCTTT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1148949510 17:51298164-51298186 CTTGAGCTATGGAGGTCAGTCGG No data
1148949501_1148949508 13 Left 1148949501 17:51298117-51298139 CCTGAATCGATCCTCCATGCTTT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1148949508 17:51298153-51298175 ACAGGTAGTCTCTTGAGCTATGG No data
1148949501_1148949509 16 Left 1148949501 17:51298117-51298139 CCTGAATCGATCCTCCATGCTTT 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1148949509 17:51298156-51298178 GGTAGTCTCTTGAGCTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148949501 Original CRISPR AAAGCATGGAGGATCGATTC AGG (reversed) Intergenic
900284652 1:1893326-1893348 AAAGCCTGGAGGATGGAATTCGG - Intergenic
906969040 1:50491015-50491037 AATGCATGGAGGATGGATAGAGG - Intronic
909044961 1:70698798-70698820 AAAGGAGGGAGGATTGATTGAGG - Intergenic
911779806 1:101861931-101861953 GAAGCATGGAGCATCCAATCAGG + Intronic
918017429 1:180649765-180649787 AAAGGATGGAGGAAGGACTCAGG - Intronic
918948380 1:191100719-191100741 AAAGAATGGAGTATCTATTTAGG - Intergenic
920926499 1:210346563-210346585 AAAGCATGAATGATTGCTTCTGG + Intronic
923052423 1:230398132-230398154 AAGGCAGGGAGGCTGGATTCTGG - Intronic
1065889917 10:30112134-30112156 ACAGAATGGAGGACCGATGCAGG + Intronic
1066444047 10:35465583-35465605 AAAGCATGCAAGGTGGATTCAGG - Intronic
1075240522 10:120774397-120774419 AGAGCATGGAGAATCTATTTGGG + Intergenic
1079363072 11:19785900-19785922 AAAGCATGTAGCATGTATTCAGG - Intronic
1081042160 11:38225775-38225797 AGAGCATGGGGCATTGATTCAGG + Intergenic
1085801451 11:79593740-79593762 AAAGAATGGAGGATGACTTCAGG - Intergenic
1086175177 11:83883393-83883415 AAAGTATGGATGATGGATTAAGG - Intronic
1086721203 11:90123634-90123656 AATGCATGGATTATAGATTCTGG + Intergenic
1087019886 11:93591332-93591354 CAAGGCAGGAGGATCGATTCAGG + Intergenic
1088715970 11:112550029-112550051 AAACCATGGAAGATCATTTCAGG - Intergenic
1089530046 11:119121756-119121778 AAAGCAGGGAGGTTCCAGTCGGG - Intronic
1090194297 11:124801163-124801185 AAAGCACGGAGGATGGAGACTGG - Intergenic
1093563383 12:20571311-20571333 ACAGCATTGAGGATTGATACAGG + Intronic
1100279361 12:93103683-93103705 CAAGCATGGACGATGGATTAGGG - Intergenic
1109548316 13:63859233-63859255 AAATCATGGAGGATGGGTTCTGG - Intergenic
1109741170 13:66557917-66557939 CAAGACTGGAGGATCGCTTCAGG + Intronic
1113404048 13:110021736-110021758 ACAGGATGGAGGATAGATTTAGG + Intergenic
1118311191 14:64694361-64694383 AAGGCAAGGAGGATGGCTTCTGG - Intergenic
1119579996 14:75769797-75769819 AAAGCTTATAGGATTGATTCAGG + Intronic
1122139697 14:99655387-99655409 CAAGCAAGGAGGATCGCTTGAGG + Intronic
1122281294 14:100623979-100624001 AAAGCATGGAGGCTGGAAGCAGG - Intergenic
1123830138 15:24127664-24127686 AAAGCAGGGAGGATTGCTTGTGG - Intergenic
1123845043 15:24291601-24291623 AAAGCAGGGAGGATTGCTTGTGG - Intergenic
1123860199 15:24458277-24458299 AAAGCAGGGAGGATTGCTTGTGG - Intergenic
1125830642 15:42714797-42714819 AAAGCATAAAGGATCCATTTTGG + Intronic
1132109253 15:99090262-99090284 AGAGCATGGAGGGTGGGTTCAGG - Intergenic
1134864891 16:17597159-17597181 AGAGCATGGAAGATTAATTCTGG - Intergenic
1139101855 16:63777377-63777399 AGAGCCTGGATGAACGATTCAGG + Intergenic
1140145917 16:72308641-72308663 AATACATGGAGGATAGAATCAGG + Intergenic
1140841754 16:78846037-78846059 AAAGCATGGAGTTTGGAATCTGG + Intronic
1141251941 16:82367296-82367318 AAAGCATGGAGCAGCCATGCAGG + Intergenic
1148875763 17:50686288-50686310 AAACCGTGGAGGCTCGTTTCTGG - Intronic
1148949501 17:51298117-51298139 AAAGCATGGAGGATCGATTCAGG - Intergenic
1151358716 17:73575650-73575672 AAAGCATGTAGGATTGCGTCTGG + Intronic
1155874895 18:31074071-31074093 AGAGAATAGGGGATCGATTCAGG + Intronic
1156756760 18:40537014-40537036 AAAGCATGAAGGATCATTTTAGG - Intergenic
1156955440 18:42957235-42957257 AAAGCATGAAGGATGCATTATGG - Intronic
1157944175 18:51959971-51959993 AAAACATGGAAGTTCGAATCTGG - Intergenic
1160196953 18:76763553-76763575 AAAAAATAGAGGATCAATTCAGG - Intergenic
1160410635 18:78673385-78673407 ATAGCATGGAGCGTGGATTCTGG - Intergenic
1161704563 19:5813140-5813162 AAAGAAGGGAGGATCGCTTGAGG + Intergenic
1162062848 19:8107293-8107315 AAAGGATGGAGGATAGATGAAGG + Intronic
1163828741 19:19537892-19537914 GAAGAATGGAGGGTAGATTCAGG + Intergenic
1164321805 19:24155060-24155082 AAAGCATTGAAGATGGACTCTGG - Intergenic
927299115 2:21490372-21490394 AAAGCATGCAGGATTGACTCAGG + Intergenic
927468439 2:23354162-23354184 AAAGCATCGAGGCTCGACTGTGG + Intergenic
930178703 2:48328275-48328297 ATATCATGGGGGATTGATTCTGG + Intronic
931183916 2:59931073-59931095 AAAGGATGTAGTATGGATTCGGG + Intergenic
933780014 2:85794921-85794943 ACAACATGGAGGCTCGACTCTGG - Intergenic
936082633 2:109445175-109445197 TAAACATGGAGGATAGATTGAGG + Intronic
938153451 2:128906141-128906163 AAAGCAAGGAGCATCCCTTCGGG - Intergenic
940168993 2:150806439-150806461 AAATCATGAAGGACAGATTCCGG - Intergenic
943189300 2:184655346-184655368 AAAGGATGGAGGATAGAGTAGGG + Intronic
945074792 2:206027464-206027486 AAAGGTGGGAGGATCGCTTCAGG + Intronic
1170236781 20:14115189-14115211 AAAGCACAGTGGATCAATTCGGG + Intronic
1170524355 20:17223512-17223534 AAAGCAAGGAGCATCAAGTCAGG - Intergenic
1173559654 20:43993918-43993940 AAAGCAGGGAGGATTGCTTGAGG + Intronic
1173932581 20:46833043-46833065 AAAGCTTAGAGGAGAGATTCTGG - Intergenic
1178959969 21:37056621-37056643 AAAGCAAGGAGGAACAAGTCAGG - Intergenic
1184379473 22:44136138-44136160 AAAGCATAGAGGATCCCTTTGGG + Intronic
950406750 3:12809778-12809800 AAAGCATAGAGGATCTAGTAAGG - Intronic
951120266 3:18918379-18918401 AAAGCATAAAGAATCGATTTTGG - Intergenic
952439342 3:33309926-33309948 TAAGCAGGGAGGATCGCTTGAGG + Intronic
955448917 3:59046552-59046574 AAATTATGGATGATGGATTCTGG + Intronic
957357488 3:79111312-79111334 AAAGTTTAGAGGATCGATTGGGG + Intronic
960306996 3:116074094-116074116 AAACCAAGGAGAATCTATTCAGG - Intronic
960812144 3:121635650-121635672 AAGGCATGGAGGATATAGTCTGG + Intronic
962220720 3:133562591-133562613 CAAGGAAGGAGGATCGCTTCAGG - Intergenic
962884578 3:139612182-139612204 AATGCATAGAGGATACATTCTGG + Intronic
964743073 3:159987971-159987993 ACAGCATGAAGGATGGATCCAGG - Intergenic
966234255 3:177683127-177683149 AAGGCATGGATGATAGACTCTGG - Intergenic
970000195 4:11357386-11357408 AAAGCAAGGAGGAGCAAGTCAGG - Intergenic
974940618 4:68463171-68463193 AAAGCAAGGTGGATCATTTCTGG + Intronic
977324499 4:95557559-95557581 AAATCATGGAGTATCCATTTAGG + Intergenic
980399748 4:132266769-132266791 AAAACATGTAGCATCAATTCAGG - Intergenic
981946473 4:150350613-150350635 AAACCAAGGAGGACAGATTCTGG - Intronic
982380217 4:154741843-154741865 AAAGCATGGAGAATTGCTTCAGG - Intronic
983550814 4:169015624-169015646 AAACCATACAGTATCGATTCTGG - Intergenic
984588322 4:181588052-181588074 AAAGCAGGGAGCATCCACTCAGG + Intergenic
987824684 5:23014614-23014636 AAAGCATGCAGGATTTATTATGG + Intergenic
988465635 5:31488901-31488923 AAAGAATTGAGGATCATTTCTGG + Intronic
989970597 5:50520390-50520412 AAGGCATGAGGGATCGATGCTGG - Intergenic
993479282 5:88403264-88403286 AAAGCGGGGAGGAGGGATTCAGG - Intergenic
995141814 5:108743738-108743760 AAAAAATGTAGGATCAATTCAGG - Intergenic
996445108 5:123539064-123539086 AAAGCCTGGAGGATTGCTTGAGG - Intronic
1001450223 5:171818840-171818862 AAATCAAGGATGATTGATTCAGG + Intergenic
1004428432 6:15522403-15522425 AAAGAATGGAGGATTGCTTTGGG + Intergenic
1006562119 6:34922665-34922687 AGAGCATGGAGGATTGAATCTGG + Intronic
1007366106 6:41394393-41394415 AAAGCATGGAGGAAAAACTCAGG + Intergenic
1009628541 6:66166198-66166220 GAAGCATGGGGCATTGATTCAGG + Intergenic
1013596761 6:111667484-111667506 GAAGCAGGGAGGATCGCTTGAGG - Intronic
1015194884 6:130514931-130514953 AAAGCATGGAGTACTGACTCAGG + Intergenic
1027446792 7:78282868-78282890 AAATCATGAAGGATCCATTTTGG - Intronic
1030626988 7:111855127-111855149 AGGGCATGGAAGATCAATTCTGG + Intronic
1031774873 7:125895733-125895755 AAAGAAGGGAGGATTGATTGAGG + Intergenic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1043201624 8:77376380-77376402 AAAGCATGGAGGTCCCATTTGGG + Intergenic
1043508911 8:80930857-80930879 ACAGCATGGTGGCTGGATTCTGG + Intergenic
1045420643 8:102011317-102011339 AAAGAATGCAGGATTGATCCAGG - Intronic
1051195075 9:14555352-14555374 AAACCATGGAGGAAAGATTTGGG + Intergenic
1051295085 9:15587043-15587065 CAAGCTTGGAGGATTGATTGTGG - Intronic
1060540432 9:124426377-124426399 AAAGCCTGGAGGATTGTTCCAGG - Intergenic
1189522704 X:41786464-41786486 GAAGCAGGGAGGATTGATTGAGG - Intronic
1197964665 X:132046187-132046209 AAAGCAAGCAGGATACATTCTGG - Intergenic
1198068410 X:133123075-133123097 AAAGAATGGGGGTTAGATTCTGG + Intergenic
1199948197 X:152683818-152683840 ATAGCATGCAGGATCACTTCTGG - Intergenic
1199961482 X:152784636-152784658 ATAGCATGCAGGATCACTTCTGG + Intergenic
1201860309 Y:18590569-18590591 AAACCATGATGGATCGATTAAGG + Intergenic
1201873014 Y:18729812-18729834 AAACCATGATGGATCGATTAAGG - Intergenic